Article Figures & Data
Figures
- FIG. 1.
Nucleotide sequence alignment of the open reading frames of CTX-M-9 36; this study), CTX-M-13 (this study), CTX-M-14 (this study), and Toho-2 (29). Dots indicate identical nucleotides. Hyphens show nucleotide deletions. Amino acids in parentheses indicate substitutions compared with the sequence of CTX-M-9. The numbering is according to Ambler et al. (1). The asterisk at the end indicates the stop codon.
- FIG. 2.
(a) Plasmid DNA profiles of the clinical isolates carrying blaCTX-M genes and their transconjugants; (b) Southern blots hybridized with a blaCTX-M-specific probe. Lanes A, V517 plasmid size marker; lanes B and C, E. coli strain 8 and its transconjugant (blaCTX-M-14), respectively; lanes D and E, E. coli strain 7 and its transconjugant (blaCTX-M-14), respectively; lanes F and G, K. pneumoniae strain 1 and its transconjugant (blaCTX-M-13), respectively; lanes H and I, K. pneumoniae strain 2 and its transconjugant (blaCTX-M-14), respectively; lanes J and K, E. coli strains 5 and 6, respectively (blaCTX-M-14); lanes L, E. cloacae strain 3 (blaCTX-M-14); lanes M and N, E. cloacae strain 1 and its transconjugant (blaCTX-M-9), respectively.
Tables
- TABLE 1.
Oligonucleotide primers used in the study
Gene or gene region Primer Oligonucleotide sequence (5"→3") GenBank accession no. (reference) Position of primera bla CTX-M C-1 AACACGGATTGACCGTCTTG D89862 (29) 82-101 C-2 TTACAGCCCTTCGGCGAT D89862 981-964 C-3 GCTGGTTCTGGTGACCTATTTTACCC D89862 881-907 C-5 CCAGCAGCAGCGGAATGCAC D89862 175-156 Downstream C-4 GTTGTCGGGAAGATACGTGA AF252622 (this study) 2683-2664 C-6 CATCACGACTGTGCTGGTCATTAAAC AF252622 2860-2885 C-7 GAAATCGCACACCTGGTAATTGATTC AF252622 3035-3050 Upstream C-8 CACTCACCTCACAAGCAACGAA AJ242809 (unpublished) 902-923 C-9 AAATTGACATCCATTACGATTGA AJ242809 553-575 C-10 TGAGAATGCAAAAAGCAATGGG AJ242809 252-273 C-11 CTTCAAAAAGCATAATCAAAGCCT AJ242809 19-43 C-12 ACCATATATCGAGTCATAAAAGCTGA AJ242809 146-121 C-13 AAAAATCCCATTGCTTTTTGCATTCT AJ242809 279-254 ↵ a Position counted from the first nucleotide of the entire sequence, as numbered for the GenBank submission.
- TABLE 2.
Sources of the 15 clinical isolates used in the study
Organism Date collected (day/mo/yr) Ward Specimena Clinical diagnosis Antibiotic therapyb E. coli 1 13/06/97 Respiratory Sputum Bronchopneumonia secondary to chronic bronchitis Unknown E. coli 2 15/08/97 Cardiology Sputum Bronchopneumonia secondary to chronic bronchitis and emphysema None E. coli 3 19/03/97 Pediatric NS Unknown Unknown E. coli 4 24/10/97 Pediatric US Neonatal intracerebral bleeding Penicillin E. coli 5 21/10/98 Respiratory Sputum Low differentiation squamous cell cancer of right lung and chronic pneumonia None E. coli 6 23/10/98 Respiratory Sputum Multiple thrombi, cerebral embolus, and aspiration pneumonia None E. coli 7 30/10/98 Gastroenterology Blood Rectal carcinoma and pneumonia secondary to obstruction Ceftriaxone E. coli 8 06/03/98 Hematology Urine Myelodysplastic syndrome and urinary tract infection None K. pneumoniae I 05/10/98 Neurology Sputum Thrombic cerebral embolus and pneumonia None K. pneumoniae 2 21/10/98 Urology Sputum Diabetes mellitus and peripheral neuritis Unknown K. pneumoniae 3 28/10/98 Respiratory Sputum Chronic bronchitis and chronic pulmonary emphysema Ceftriaxone E. cloacae 1 07/03/97 Neurology Sputum Thrombic cerebral embolus and pneumonia Unknown E. cloacae 2 24/04/97 Hematology Sputum Acute myeloblastic leukemia with pneumonia Unknown E. cloacae 3 07/10/98 Chinese medicine Sputum Pneumonia secondary to Parkinson's disease None C. freundii 18/03/97 Surgery Sputum Left temporal bone defect Unknown - TABLE 3.
Phenotypic and genotypic characterization of the 15 clinical isolates
Genus species MICa (μg/ml) pI β-Lactamase(s) detected by PCRb PFGE pattern Plasmid profile (kb) ATM CTX CTX+ CAZ CAZ+ E. coli 1 128 8 0.5 64 4 5.4, 8.2 SHV-12, TEM-1B∗ Eco-1 130, 10, 8.5 Transconjugantc 32 2 0.5 16 2 NTd SHV-12 130 E. coli 2 8 32 ≤0.25 2 ≤0.25 5.4, 8.1 CTX-M-9, TEM-1B Eco-2 150, 7.0, 5.0, 4.0 Transconjugant 4 16 ≤0.25 1 ≤0.25 NT CTX-M-9 150, 5.0, 4.0 E. coli 3 4 16 ≤0.25 1 ≤0.25 5.4, 8.1 CTX-M-9, TEM-1B Eco-2 150, 7.0, 5.0, 4.0 Transconjugant 2 8 ≤0.25 0.5 ≤0.25 NT CTX-M-9 150, 5.0, 4.0 E. coli 4 2 32 NT 0.5 ≤0.25 8.1 CTX-M-9 Eco-3 150 E. coli 5 >128 128 NT >128 0.25 8.1 CTX-M-14, SHV-12, TEM-1B Eco-4 130, 3.5 E. coli 6 128 64 NT 64 1 8.1 CTX-M-14, SHV-12, TEM-1B Eco-4 130, 3.5 E. coli 7 4 32 ≤0.25 1 ≤0.25 5.4, 8.1 CTX-M-14, TEM-1B Failede 130 Transconjugant 4 16 ≤0.25 0.5 ≤0.25 NT CTX-M-14 130 E. coli 8 16 64 ≤0.25 4 0.5 5.4, 8.1 CTX-M-14, TEM-1B∗ Eco-5 130, 5.5, 4.8, 3.5, 2.5, 1.9 Transconjugant 4 8 ≤0.25 1 ≤0.25 NT CTX-M-14 130 K. pneumoniae 1 16 128 16 32 64 5.4, 7.6, 8.2 CTX-M-13, TEM-1B, SHV-11 Kp-1 55, 35, 7.0 Transconjugant 8 32 ≤0.25 2 ≤0.25 NT CTX-M-13 35 K. pneumoniae 2 128 >128 ≤0.25 32 1 7.6, 8.1 CTX-M-14, SHV-11 Kp-2 150, 60, 7.0 Transconjugant 4 32 ≤0.25 1 ≤0.25 NT CTX-M-14 60 K. pneumoniae 3 16 32 NT 8 16 8.1 CTX-M-9 Kp-3 150, 7.0, 2.7, 1.9 E. cloacae 1 32 >128 0.5 8 0.5 8.1, 9.25 CTX-M-9 Ecl-1 85, 2.4 Transconjugant 8 32 ≤0.25 2 ≤0.25 NT CTX-M-9 Plasmid not found E. cloacae 2 64 16 0.5 64 ≤0.25 5.4, 9.25 SHV-12, TEM-1B Ecl-2 Plasmid not found Transconjugant 8 0.5 ≤0.25 8 ≤0.25 NT SHV-12, TEM-1B Plasmid not found E. cloacae 3 >128 128 NT 128 4 8.1 CTX-M-14, SHV-12 Ecl-3 150, 2.4 C. freundii 128 8 NT 128 ≤0.25 5.4, 8.2 SHV-12, TEM-1B NT 7.0 ↵ a ATM, aztreonam; CAZ, ceftazidime; CAZ+, ceftazidime plus 4 μg of clavulanic acid per ml; CTX, cefotaxime; CTX+, cefotaxime plus 4 μg of clavulanic acid per ml.
↵ b The blaSHV and blaCTX-M genes were characterized by nucleotide sequence analysis, and the blaTEM gene was characterized by PCR-RFLP (2). An asterisk indicates the blaTEM gene that was confirmed by nucleotide sequence analysis.
↵ c All transconjugants except those of E. cloacae 2 were E. coli UB1637 transconjugants; the E. cloacae 2 transconjugant was an E. coli UB5201 transconjugant.
↵ d NT, not tested.
↵ e Despite retesting, no DNA fragments were seen.
