Article Figures & Data
Figures
- FIG. 1.
Overlap of genes regulated by isoniazid, thiolactomycin, or triclosan treatment of M. tuberculosis. Numbers within the sectors indicate the total numbers of genes regulated uniquely or in common by either 1× or 5× MIC treatment of each drug at either 2 or 6 h (P < 0.001). INH, isoniazid; TLM, thiolactomycin; TRC, triclosan.
- FIG. 2.
Two-dimensional cluster analysis of the drug-treated expression profiles. Two-dimensional agglomerative clustering was performed on the 877 genes significantly regulated in response to any of the drug treatments (P < 0.001). The individual genes are represented on the x axis and the different samples are indicated on the y axis. Red, upregulation; green, downregulation; black, no change relative to the time zero control. INH, isoniazid; TLM, thiolactomycin; TRC, triclosan.
- FIG. 3.
Response of the kas operon to isoniazid, thiolactomycin, or triclosan treatment as measured by QRT-PCR. (A) Schematic representation of the kas operon in the M. tuberculosis H37Rv genome. Ratio between the number of cDNA copies detected in each sample relative to the time zero control by QRT-PCR at 2 h (B) and 6 h (C) is represented. Each value is the average of two biological replicates, each analyzed in duplicate. INH, isoniazid; TLM, thiolactomycin; TRC, triclosan.
- FIG. 4.
Genes induced by triclosan treatment of M. tuberculosis as measured by QRT-PCR. Organization of Rv1685c to Rv1687c (A) and Rv3160c to Rv3161c (C) in the M. tuberculosis H37Rv genome. Ratio between the number of cDNA copies detected in each sample relative to the time zero control by QRT-PCR for Rv1685c to Rv1687c (B) and Rv3160c to Rv3161c (D). Each value is the average of two biological replicates, each analyzed in duplicate. TRC, triclosan.
- FIG. 5.
PCA of isoniazid, thiolactomycin, triclosan, and control expression profiles. The largest source of variance is explained on the x axis and the second largest on the y axis. Each hybridization is represented by a single point. Isoniazid treatments, circles; thiolactomycin treatments, triangles; triclosan treatments, squares; vehicle control treatments, diamonds. Two-hour treatments, open shapes; 6-h treatments, closed shapes. 1× MIC, black; 5× MIC, red; vehicle control, blue.
Tables
- TABLE 1.
Primers used for the QRT-PCR
Gene Forward primer Reverse primer sigA TTCGCGCCTACCTCAAACAG GCTAGCTCGACCTCTTCCTCG fabD ACCCTGGTCTCCCAGCTCAC AGTTCGCGTTTGGCGATACC acpM CAAGTACGGCGTCAAGATCCC ACTTGGACTCGGCCTCAAGC kasA TGCTCATCGAGACGGAGGAG CTACCGGCACGAACACCATC kasB CCGTGCAGAAGTACATGCCC ACCGCTTCGATCCTGGTCTC accD6 CACACCGTTCGACGAGTTCC TCTGCGCTTTCGGAGTTCAG Rv1685c ACTTCGGCACCAAACAGCAG AACCGAGTTCCTCGACAGGC Rv1686c TGATGTTTGTGATCACGGCG GAACCAGAACGCCACAATGC Rv1687c GGTCGGGCAAGACAACACTG AGAGTTCGGCGAAGTAGCGG Rv3160c CTGGACCACCTGCATGCTTC CCATCTCCGCGACTAGCTCC Rv3161c CAGGGTTCCCTTCACCGTTC GCGGAATAAAGCCGAACCAC - TABLE 2.
Numbers of genes regulated in M. tuberculosis by each drug's indicated MIC, according to functional class, at 2 and 6 ha
Functional classb Total no. on array 2 h 6 h 1×-MIC INH 5×-MIC INH 1×-MIC TLM 5×-MIC TLM 1×-MIC TRC 5×-MIC TRC 1×-MIC INH 5×-MIC INH 1×-MIC TLM 5×-MIC TLM 1×-MIC TRC 5×-MIC TRC Up Down Up Down Up Down Up Down Up Down Up Down Up Down Up Down Up Down Up Down Up Down Up Down 0: Virulence, detoxification, adaptation 98 1 0 1 0 1 0 1 2 2 0 9 4 0 2 1 4 1 1 0 0 0 1 9 13 1: Lipid metabolism 231 4 1 5 1 14 1 5 0 3 1 11 16 1 0 5 4 8 2 6 3 1 3 13 27 2: Information pathways 224 2 0 0 2 15 3 0 0 2 6 8 49 1 0 1 1 0 2 1 0 0 8 6 60 3: Cell wall and cell processes 699 4 1 3 1 14 4 4 1 14 1 44 24 2 1 14 4 3 4 4 6 9 0 51 33 5: Insertion sequences and phages 141 0 1 0 0 0 3 0 0 2 0 12 1 0 0 1 0 0 0 0 1 2 0 10 1 6: PE/PPE 142 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 7: Intermediary metabolism and respiration 889 7 7 4 2 17 6 1 5 21 4 54 23 2 2 5 5 0 4 1 2 6 0 54 57 8: Unknown 265 0 4 0 0 3 6 1 1 2 2 10 7 0 0 1 0 0 0 0 0 0 0 32 11 9: Regulatory proteins 186 0 2 1 2 0 1 1 1 2 3 17 2 1 0 1 2 0 1 0 1 1 0 25 4 10: Conserved hypothetical proteins 1,005 7 10 6 2 14 9 1 5 11 7 42 42 2 3 9 4 2 1 4 1 7 0 87 56 Total 3,880 25 26 20 10 78 33 14 15 59 24 207 168 9 8 38 24 14 15 16 14 26 12 288 262 ↵ a INH, isoniazid; TLM, thiolactomycin; TRC, triclosan; Up and Down, up- and downregulated.
↵ b According to TubercuList (http://genolist.pasteur.fr/TubercuList/ ).
- TABLE 3.
Genes commonly regulated by the drug treatments
ORF Gene name Description Functional classa Induced by isoniazid, thiolactomycin, and triclosan Rv0040c mtc28 Secreted proline-rich protein 3 Rv1987 Possible chitinase 3 Rv3354 Conserved hypothetical protein 10 Downregulated by isoniazid, thiolactomycin, and triclosan Rv0352 dnaJ1 Probable chaperone protein 0 Rv0790c Hypothetical protein 8 Rv0823c Possible transcriptional regulatory protein 9 Rv0824c desA1 Probable acyl-[ACP] desaturase 1 Rv1094 desA2 Possible acyl-[ACP] desaturase 1 Rv2840c Conserved hypothetical protein 10 Induced by isoniazid and thiolactomycin Rv0179c lprO Possible lipoprotein 3 Rv0207c Conserved hypothetical protein 10 Rv0312 Conserved hypothetical proline- and threonine-rich protein 10 Rv0342 iniA Isoniazid-inducible gene protein 3 Rv0359 Probable conserved integral membrane protein 3 Rv0569 Conserved hypothetical protein 10 Rv0951 sucC Probable succinyl coenzyme A synthetase (beta chain) 7 Rv1592c Conserved hypothetical protein 10 Rv1736c narX Probable nitrate reductase 7 Rv2007c fdxA Probable ferredoxin 7 Rv2193 ctaE Probable cytochrome c oxidase (subunit III) 7 Rv2243 fabD Malonyl coenzyme A-acyl carrier protein transacylase 1 Rv2244 acpM Meromycolate extension acyl carrier protein 1 Rv2245 kasA β-Ketoacyl-[ACP] synthase 1 1 Rv2246 kasB β-Ketoacyl-[ACP] synthase 2 1 Rv2428 ahpC Alkyl hydroperoxide reductase C 0 Rv2721c Possible conserved transmembrane alanine- and glycine-rich protein 3 Rv2846c efpA Possible integral membrane efflux protein 3 Rv3134c Conserved hypothetical protein 10 Rv3456c rplQ Probable 50S ribosomal protein L17 2 Rv3524 Probable conserved membrane protein 3 ↵ a Functional classes are listed in Table 1.
- TABLE 4.
Differential response of the kas operon to isoniazid, thiolactomycin, or triclosan treatment
Treatmenta and time fabD acpM kasA kasB accD6 Ratiob P value Ratio P value Ratio P value Ratio P value Ratio P value 5×-MIC INH, 2 h 1.53 3.06 × 10−4 3.15 <1.00 × 10−46 2.81 2.78 × 10−29 2.78 1.49 × 10−28 NS 5×-MIC INH, 6 h 2.27 <1.00 × 10−46 4.53 <1.00 × 10−46 4.40 1.87 × 10−31 3.54 <1.00 × 10−46 NS 1×-MIC TLM, 2 h 2.26 1.54 × 10−4 4.30 <1.00 × 10−46 3.79 4.77 × 10−15 3.42 1.09 × 10−18 1.69 1.12 × 10−11 5×-MIC TLM, 2 h NS 3.70 <1.00 × 10−46 2.94 7.92 × 10−20 2.08 1.43 × 10−6 1.41 8.06 × 10−5 1×-MIC TLM, 6 h 1.88 9.48 × 10−6 3.01 <1.00 × 10−46 2.87 5.33 × 10−39 2.10 8.86 × 10−10 1.41 8.36 × 10−4 5×-MIC TLM, 6 h 1.79 5.01 × 10−6 4.00 <1.00 × 10−46 2.93 4.49 × 10−37 2.41 1.61 × 10−14 NS 5×-MIC TRC, 2 h NS 0.24 3.30 × 10−24 0.30 8.29 × 10−15 0.36 6.27 × 10−9 NS 5×-MIC TRC, 6 h NS 0.13 <1.00 × 10−46 0.20 <1.00 × 10−46 0.34 5.37 × 10−25 NS - TABLE 5.
Genes induced in M. tuberculosis by all triclosan (TRC) treatments
ORF Gene name Description Functional classa MIC and exposure time 1×-MIC TRC, 2 h 5×-MIC TRC, 2 h 1×-MIC TRC, 6 h 5×-MIC TRC, 6 h Ratiob P value Ratio P value Ratio P value Ratio P value Rv0077c Probable oxidoreductase 7 1.88 1.05 × 10−6 5.46 3.33 × 10−8 1.60 1.87 × 10−11 3.57 7.01 × 10−45 Rv0711 atsA Possible arylsulfatase 7 2.64 4.48 × 10−17 3.16 <1.00 × 10−46 1.65 4.40 × 10−7 1.92 1.86 × 10−29 Rv1557 mmpL6 Probable conserved transmembrane transport protein 3 2.16 5.31 × 10−16 1.67 2.71 × 10−12 1.41 9.25 × 10−8 1.66 2.59 × 10−19 Rv1685c Conserved hypothetical protein 10 17.89 <1.00 × 10−46 21.20 3.06 × 10−26 13.15 <1.00 × 10−46 21.17 <1.00 × 10−46 Rv1686c Probable conserved integral membrane protein, ABC transporter 3 14.99 <1.00 × 10−46 16.58 <1.00 × 10−46 11.02 <1.00 × 10−46 21.30 <1.00 × 10−46 Rv1687c Probable conserved ATP-binding protein, ABC transporter 3 6.95 3.49 × 10−26 12.95 1.26 × 10−17 5.06 <1.00 × 10−46 11.16 <1.00 × 10−46 Rv3160c Possible transcriptional regulatory protein (probably TetR family) 9 2.40 4.62 × 10−6 9.51 2.34 × 10−18 2.01 3.35 × 10−9 8.63 <1.00 × 10−46 Rv3161c Possible dioxygenase 7 4.77 1.03 × 10−39 18.92 <1.00 × 10−46 4.40 <1.00 × 10−46 18.42 <1.00 × 10−46 - TABLE 6.
The genes and discriminant function required for classification of isoniazid (INH), thiolactomycin (TLM), triclosan (TRC), or control groups
ORF Gene name Description Avg squared canonical correlationa INH [D2INH (x)]b TLM [D2TLM (x)] TRC [D2TRC (x)] Control [D2Control (x)] Constant −14,987,826 −167,097,220 −79,450,033 −5,513,637 Rv1686c Probable conserved integral membrane protein ABC transporter 0.3325 −19,099,766 −100,023,236 −36,942,559 −19,032,909 Rv2244 acpM Meromycolate extension acyl carrier protein 0.6111 110,774,262 408,156,465 243,639,840 72,779,372 Rv0677c mmpS5 Possible conserved membrane protein 0.8533 121,600,815 512,108,617 316,180,097 94,776,642 Rv2190c Conserved hypothetical protein 0.8904 −68,508,665 −286,328,959 −181,659,649 −52,963,842 Rv3250c rubB Probable rubredoxin 0.8954 −10,150,989 −44,990,430 −22,707,705 −8,353,423 Rv2276 cyp121 Cytochrome P450 121 0.9040 −36,833,310 −220,327,670 −143,773,133 −43,835,221 Rv3049c Probable monooxygenase 0.9491 −114,909,397 −452,847,559 −265,224,702 −82,194,446 Rv0208c Hypothetical methyltransferase 0.9762 −178,128,313 −821,139,430 −524,976,195 −155,439,247 Rv2745c Possible transcriptional regulatory protein 0.9817 −77,131,242 −323,842,646 −200,033,735 −59,890,920 Rv2253 Possible secreted unknown protein 0.9834 −49,162,506 −201,531,571 −124,495,122 −37,049,967 Rv1072 Probable conserved transmembrane protein 0.9843 64,061,474 246,735,357 152,824,150 44,629,671 Rv0298 Hypothetical protein 0.9865 47,211,509 172,163,109 103,076,691 30,611,076 Rv3341 metA Probable homoserine O-acetyltransferase 0.9867 1,400,025 −26,153,983 −29,413,890 −6,482,707 Rv0001 dnaA Chromosomal replication initiator protein 0.9932 −23,069,217 −86,660,290 −56,244,876 −15,604,890 Rv3457c rpoA Probable DNA-directed RNA polymerase (α chain) 0.9942 −82,964,894 −232,795,471 −118,734,295 −37,450,414 Rv1737c narK2 Possible nitrate/nitrite transporter 0.9946 −22,730,982 −62,077,538 −26,268,313 −9,791,891 Rv1871c Conserved hypothetical protein 0.9967 16,814,613 46,910,792 21,021,772 7,485,856 Rv3404c Conserved hypothetical protein 0.9971 46,788,129 124,430,283 61,274,979 19,520,565 Rv3486 Conserved hypothetical protein 0.9972 −63,601,803 −175,065,603 −83,869,339 −27,853,590 Rv3310 Possible acid phosphatase 0.9998 35,921,002 97,302,396 47,325,500 15,382,806 Rv0283 Possible conserved membrane protein 1.0000 22,910,896 62,309,712 30,137,464 9,865,584 ↵ a Cumulative canonical correlation showing the increasing amount of variance accounted for by each gene in the discriminant model.
↵ b To classify an observation (x) into one of the groups, the discriminant score [D2y (x)] is calculated for each group (y) using the above functions. These scores are inversely related to the distance that observation is from the middle of each group. The observation belongs to the group whose function gives the highest discriminant score. The probability of an observation (x) belonging to a group (y) is calculated as eDy2(x)/[eDControl2(x)+eDINH2(x)+eDTLM2(x)+eDTRC2(x)].
