Article Figures & Data
Figures
- FIG. 1.
PFGE analysis of XbaI-digested genomic DNA from carbapenem-resistant isolates of K. pneumoniae. Lane 1 contains a concatemer of phage λ DNA used as a molecular size marker. Isolates representing the predominant outbreak strain are shown in lanes 3, 4, 7 to 11, 13, and 18. Other lanes show isolates unrelated to the outbreak strain; the types represented in lanes 5 and 6 and in lanes 12 and 14 were related organisms, each isolated from two or more patients.
- FIG. 2.
Comparison of KPC enzyme sequences. The predicted 24-residue cleavable signal peptide is shaded.
- FIG. 3.
Plasmid profiles (A) and a Southern blot hybridized with a blaKPC probe (B) of K. pneumoniae CL 5761 (lanes 2) and a representative blaKPC-3-containing E. coli electrotransformant (lanes 3). Lanes 1 show the 94-kb plasmid R100.1 (22, 31) as a guide to molecular size.
- FIG. 4.
Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of OMPs extracted from carbapenem-resistant K. pneumoniae isolates. Lanes 1 and 12 show protein molecular size markers as indicated in kilodaltons to the right of the gel (Bio-Rad). Other lanes contain control strain CL 15245 (lanes 2 and 3), CL 5761 (lanes 4 and 5), CL 5762A (lanes 6 and 7), CL 5762B (lanes 8 and 9), and CL 5763 (lanes 10 and 11). Extracts in lanes 2, 4, 6, 8, and 10 were prepared from cells grown in Luria-Bertani broth (high osmolarity); those in lanes 3, 5, 7, 9, and 11 were prepared from cells grown in NB (low osmolarity). The arrow indicates the band corresponding to the inducible porin OmpK35.
Tables
- TABLE 1.
PCR primers used in this study
Gene Primer sequences (5′-3′) Product size (bp) Reference blaIMP For, CTACCGCAGCAGAGTCTTTG 587 32 Rev, AACCAGTTTTGCCTTACCAT blaVIM For, AGTGGTGAGTATCCGACAG 261 35 Rev, ATGAAAGTGCGTGGAGAC blaSME For, AACGGCTTCATTTTTGTTTAG 830 27 Rev, GCTTCCGCAATAGTTTTATCA blaKPC For, TGTCACTGTATCGCCGTC ca. 1,000 38 Rev, CTCAGTGCTCTACAGAAAACC blaIMI/blaNMC For, CCA TTC ACC CAT CAC AAC 440 This study (based on GenBank accession no. U50278) Rev, CTA CCG CAT AAT CAT TTG C waaE For, CTG TCG CGT CTG CTA CAG TT 851 This study (based on GenBank accession no. AF146532) Rev, CCG GAT AGA TCG CTT TTG TG qnr For, GAT AAA GTT TTT CAG CAA GAG G 593 10 Rev, ATC CAG ATC GGC AAA GGT TA - TABLE 2.
Details of patients from whom carbapenem-resistant K. pneumoniae was isolated
Patient Date isolated (mo/yr) Site(s) ICU type(s)a Status Outcome 1 4/00 Sputum CCU Infection Died 2 5/00 Sputum MICU Infection Died 3 5/00 Sputum MICU Colonization Recovered 4 5/00 Sputum and blood SICU Infection Died 5 5/00 Sputum and urine CCU Colonization Recovered 6 5/00 Sputum MICU Infection Recovered 7 6/00 Sputum and urine SICU Infection Recovered 8 6/00 Urine SICU Infection Recovered 9 7/00 Wound SICU and MICU Colonization Recovered 10 7/00 Sputum MICU Colonization Recovered 11 7/00 Blood and urine MICU Infection Recovered 12 7/00 Blood and urine CCU and MICU Infection Died 13 8/00 Blood SICU Infection Died 14 8/00 Blood SICU Infection Died 15 8/00 Sputum SICU Colonization Recovered 16 9/00 Sputum CVCU Infection Recovered 17 9/00 Wound SICU Infection Died 18 9/00 Sputum MICU Colonization Recovered 19 10/00 Sputum MICU Infection Died 20 12/00 Wound SICU Colonization Recovered 21 1/01 Sputum MICU Colonization Recovered 22 2/01 Sputum SICU Colonization Recovered 23 3/01 Wound SICU Colonization Recovered 24 4/01 Catheter SICU Infection Recovered ↵a CCU, coronary care unit; CVCU, cardiovascular care unit; MICU, medical intensive care unit; SICU, surgical intensive care unit; PICU, pediatric intensive care unit.
- TABLE 3.
Antibiotic susceptibilitiesa and carbapenemase activities of clinical isolates of K. pneumoniae
Antibioticb Inhibitor MIC (μg/ml) CL 5761 CL 5762A CL 5762B CL 5763 CL 15245 Imipenem − 16 2 16 16 ≤0.125 + CLAc 8 0.5 8 8 ≤0.25 Meropenem − 8 1 16 16 ≤0.125 + CLA 8 2 32 16 ≤0.125 Ertapenemd − >32 0.25 >32 >32 NTe Aztreonam − >256 256 >256 >256 ≤0.25 + CLA 256 64 >256 >256 ≤0.25 Ceftazidime − 256 256 >256 >256 ≤0.25 + CLA 128 32 256 >256 ≤0.25 Ceftriaxone − 256 >256 >256 >256 ≤0.25 + CLA 64 32 128 256 ≤0.25 Cefepime − 32 128 128 128 ≤0.25 + CLA 32 8 64 64 ≤0.25 Cefoxitin − 128 32 256 256 2 + CLA 256 32 256 256 <1 Piperacillind + Tazo- bactam >256 >256 >256 >256 NT Amikacin − 16 32 32 32 0.5 Gentamicin − 8 8 16 16 ≤0.25 Chloramphenicol − 128 64 64 128 4 Ciprofloxacin − 4 2 4 16 ≤0.06 Polymyxin B − 0.25 0.25 64 0.125 0.25 Tetracycline − 4 1 4 4 1 ↵a Antibiotic susceptibility determined by broth microdilution method except where noted.
↵b Specific activities for CL 5761, CL 5762A, CL 5762B, and CL 5763 were 0.22, 0.46, 0.50, and 0.53, nmol of imipenem hydrolyzed/min/mg of protein, respectively. The specific activity for CL 15245 was not tested.
↵c + CLA, MIC determined in presence of 4 μg of clavulanic acid/ml; −, no inhibitor.
↵d Antibiotic susceptibility determined by E test.
↵e NT, not tested.
- TABLE 4.
Antibiotic susceptibilities of E. coli transformants with the 75-kb KPC-3-encoding plasmid
Antibiotic MIC (μg/ml) for: DH5α DH5α (KPC-3)a CL 5761 Imipenem 0.12 1 8 Meropenem ≤0.03 0.25 16 Ceftazidime 0.12 16 >32 Ceftriaxone ≤0.25 4 128 Aztreonam ≤0.25 16 >256 Cefoxitin 4 8 256 Amikacin 0.5 16 16 Gentamicin 0.25 1 16 Streptomycin 2 2 2 Chloramphenicol 8 8 128 Ciprofloxacin 0.06 0.06 4 Polymyxin B 0.5 0.5 1 ↵a Boldface values indicate significantly increased MICs.
