Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About AAC
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • AAC Podcast
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Antimicrobial Agents and Chemotherapy
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About AAC
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • AAC Podcast
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
Mechanisms of Resistance

Mechanisms of Resistance to Imipenem and Ampicillin in Enterococcus faecalis

Seiji Ono, Tetsuro Muratani, Tetsuro Matsumoto
Seiji Ono
Department of Urology, School of Medicine, University of Occupational and Environmental Health, 1-1 Iseigaoka, Yahatanisi-Ku, Kitakyusyu 807-8555, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: onochan@bronze.ocn.ne.jp
Tetsuro Muratani
Department of Urology, School of Medicine, University of Occupational and Environmental Health, 1-1 Iseigaoka, Yahatanisi-Ku, Kitakyusyu 807-8555, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Tetsuro Matsumoto
Department of Urology, School of Medicine, University of Occupational and Environmental Health, 1-1 Iseigaoka, Yahatanisi-Ku, Kitakyusyu 807-8555, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI: 10.1128/AAC.49.7.2954-2958.2005
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • FIG. 1.
    • Open in new tab
    • Download powerpoint
    FIG. 1.

    Amino acid substitutions in pbp4 of E. faecalis strains. The homology boxes (STFK with active-site serine SDN and KTG) are indicated above. The positions at which resistant and low-resistant strains are altered from the sequence of the reference strain E. faecalis SEF96 are indicated.

Tables

  • Figures
  • TABLE 1.

    Bacterial strains and MIC values of selected agents

    StrainDate of isolation (day.mo.yr)Specimen and relevant characteristicsMIC (μg/ml)aBeta-lactamase produced
    AMPIPMCTXVCM
    Enterococcus faecalis
        SEF9621.04.2000Clinical isolate from urine11>2561−
        ATCC 29212Type strain112564−
        SVR 3415.02.2000Clinical isolate with vanB from urine84>25632−
        SVR 13827.05.2002Clinical isolate with vanA from stool88>256>512−
        SVR 25019.07.2002Clinical isolate with vanA from urine10.564>512−
        SVR 25119.07.2002Clinical isolate with vanA from urine10.564>512−
        SVR 111002.09.2000Clinical isolate with vanA from urine1632>256>512−
        SVR 111901.12.1998Clinical isolate with vanA from urine1632>256>512−
        SVR 1119SΔvanA; spontaneous mutant derived from SVR 11191632>2561
    Escherichia coli
        ATCC 35218Beta-lactamase-positive strain+
    • ↵ a Abbreviations: AMP, ampicillin; IPM, imipenem; CTX, cefotaxime; VCM, vancomycin.

  • TABLE 2.

    Primers designed for sequencing of PBP4 genes

    PrimerSequenceReference
    EF PBP4 140′F5′CAACGAAAGCCTGATGAAATGG3′This study
    EF PBP4 1043F5′CGATTGACAGTGTACAACAACAAGC3′This study
    EF PBP4 1132R5′AATCGCCTTTTTGAGGATCGG3′This study
    EF PBP4 2130R5′CGCTTCATTGTAGCACACTTTCCTTTTTC3′ 4
  • TABLE 3.

    Inhibition of binding of Bocillin FL to PBPs by two beta-lactams

    DrugE. faecalis strainIC50a (μg/ml)MIC (μg/ml)
    PBP1PBP3PBP4PBP5
    AmpicillinSEF9610.50.25>161
    ATCC 2921210.50.25>161
    SVR 25020.51>81
    SVR 25120.50.25>81
    SVR 3420.54>328
    SVR 13820.54>328
    SVR 111010.58>3216
    SVR 111910.258>3216
    ImipenemSEF960.50.250.25>161
    ATCC 292120.50.250.125>161
    SVR 25010.50.25>80.5
    SVR 2510.50.250.5>80.5
    SVR 340.50.254>324
    SVR 1380.50.254>324
    SVR 111010.532>3232
    SVR 111910.2516>3232
    • ↵ a IC50, concentration of unlabeled antibiotic which reduces binding of Bocillin FL to a PBP by more than 50%.

  • TABLE 4.

    Amino acid alterations in strains in this study compared with E. faecalis SEF96

    StrainMICs (μg/ml), ampicillin/imipenemIC50 (μg/ml), ampicillin/imipenemAlteration at position:
    50369520605
    SEF961/10.25/0.25TyrValProTyr
    ATCC 292121/10.25/0.125Ala
    SVR 2501/0.51/0.25Ile
    SVR 2511/0.50.25/0.5Ile
    SVR 348/44/4His
    SVR 1388/44/4His
    SVR 111016/328/32SerHis
    SVR 111916/328/32SerHis
PreviousNext
Back to top
Download PDF
Citation Tools
Mechanisms of Resistance to Imipenem and Ampicillin in Enterococcus faecalis
Seiji Ono, Tetsuro Muratani, Tetsuro Matsumoto
Antimicrobial Agents and Chemotherapy Jun 2005, 49 (7) 2954-2958; DOI: 10.1128/AAC.49.7.2954-2958.2005

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Antimicrobial Agents and Chemotherapy article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Mechanisms of Resistance to Imipenem and Ampicillin in Enterococcus faecalis
(Your Name) has forwarded a page to you from Antimicrobial Agents and Chemotherapy
(Your Name) thought you would be interested in this article in Antimicrobial Agents and Chemotherapy.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
Mechanisms of Resistance to Imipenem and Ampicillin in Enterococcus faecalis
Seiji Ono, Tetsuro Muratani, Tetsuro Matsumoto
Antimicrobial Agents and Chemotherapy Jun 2005, 49 (7) 2954-2958; DOI: 10.1128/AAC.49.7.2954-2958.2005
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
    • ABSTRACT
    • MATERIALS AND METHODS
    • RESULTS
    • DISCUSSION
    • FOOTNOTES
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • PDF

KEYWORDS

ampicillin
Anti-Bacterial Agents
Drug Resistance, Bacterial
Enterococcus faecalis
imipenem
penicillin-binding proteins

Related Articles

Cited By...

About

  • About AAC
  • Editor in Chief
  • Editorial Board
  • Policies
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • AAC Podcast
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Ethics
  • Contact Us

Follow #AACJournal

@ASMicrobiology

       

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

Print ISSN: 0066-4804; Online ISSN: 1098-6596