Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About AAC
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • AAC Podcast
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Antimicrobial Agents and Chemotherapy
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About AAC
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • AAC Podcast
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
Mechanisms of Resistance

New Cluster of Plasmid-Located Class 1 Integrons in Vibrio cholerae O1 and a dfrA15 Cassette-Containing Integron in Vibrio parahaemolyticus Isolated in Angola

Daniela Ceccarelli, Anna Maria Salvia, Joana Sami, Piero Cappuccinelli, Mauro Maria Colombo
Daniela Ceccarelli
1Dipartimento Biologia Cellulare e dello Sviluppo, Universitá La Sapienza, Via dei Sardi 70, 00185 Rome, Italy
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Anna Maria Salvia
1Dipartimento Biologia Cellulare e dello Sviluppo, Universitá La Sapienza, Via dei Sardi 70, 00185 Rome, Italy
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Joana Sami
2Institute of National Public Health, Mininistry of Health, Luanda, Angola
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Piero Cappuccinelli
3Dipartimento Scienze Biomediche, Facolta di Medicina Universitá di Sassari, Viale San Pietro 42B, 07100 Sassari, Italy
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Mauro Maria Colombo
1Dipartimento Biologia Cellulare e dello Sviluppo, Universitá La Sapienza, Via dei Sardi 70, 00185 Rome, Italy
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: mauro.colombo@uniroma1.it
DOI: 10.1128/AAC.01310-05
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • FIG. 1.
    • Open in new tab
    • Download powerpoint
    FIG. 1.

    Map of the 19-kb region on the p3iANG plasmid, clustering together the three integrons and chloramphenicol, kanamycin, and tetracycline resistance genes (approximate sizes; not to scale). The upper and lower lines represent the amplicons obtained by the primer pairs as indicated and oriented by arrows. Primer pairs and resulting amplicons for sequencing the 3.30-kb amplicon are described in the text; the 140-bp junction between the two integrons is indicated by the solid black rectangle. Sequence DQ227350 corresponds to the 3.3-kb 3′CSrev/5′CSrev amplicon. Sequence DQ149925 corresponds to the contiguous 1.5-kb In-F/In-B amplicon.

Tables

  • Figures
  • TABLE 1.

    Vibrio strains under study

    StrainDate of isolation (day/mo/yr)Place of isolation (Angolan province)Resistances in addition to common profilea
    V. cholerae O1 58204/03/92LuandaKAN, SUL, TMP, TET
    V. cholerae O1 58309/03/92LuandaKAN, SUL, TMP, TET
    V. cholerae O1 58810/03/92LuandaERY, KAN, SUL, TMP, TET
    V. cholerae O1 61126/03/92LuandaKAN, SUL, TMP, TET
    V. cholerae O1 64721/04/92LuandaKAN, SUL, TMP, TET
    V. cholerae O1 81728/06/94Bengo (Caxito)KAN, SUL, TMP, TET
    V. cholerae O1 81928/06/94Bengo (Dondo)KAN, SUL, TMP, TET
    V. cholerae O1 138309/11/94BenguelaKAN, SUL, TMP, TET
    V. cholerae O1 135623/11/94Cuando CubangoKAN, SUL, TMP, TET
    V. cholerae O1 136103/05/95CabindaKAN, SUL, TMP, TET
    V. cholerae O1 90816/04/96CabindaERY, KAN, SUL, TMP, TET
    V. parahaemolyticus 57006/12/91LuandaSUL, TMP
    V. parahaemolyticus 58617/03/92LuandaSUL, TMP
    V. cholerae non-O1 698b02/03/93Bengo RiverERY, SUL, TET
    V. cholerae O1 547b31/09/94Bengo RiverKAN, SUL, TMP, TET
    • ↵ a Abbreviations: AMP, ampicillin; CHL, chloramphenicol; ERY, erythromycin; KAN, kanamycin; PEN, penicillin; STR, streptomycin; SPT, spectinomycin; SUL, sulfamethoxazole; TET, tetracycline; TMP, trimethoprim. The common profile is resistance to AMP, CHL, PEN, STR, and SPT.

    • ↵ b Environmental isolate.

  • TABLE 2.

    PCR primers used in this study

    Primer and purposeSequence (5′ to 3′)Target gene or descriptionAmplicon size (bp)Reference, accession no., and/or chromosomal locationd
    Class 1 integron and cassette detection
        In-FGGCATCCAAGCAGCAAGClass 1 integronVariable 23
        In-BAAGCAGACTTGACCTGA
        Dfr-BaTCACCTTCTGGCTCAATGTCG dfrA15 490Z83311, bp 374-354
        Aad-BaGCCGACTACCTTGGTGATCTCG aadA1 1,476AY103457, bp 786-765
        blaP1-BaCTGGTTCATTTCAGATAGCG blaP1 874 11
    Integron cluster mapping and characterization
        3′CSrevAGTCCAGTTCAGACGAAIntegron spacersVariableU12338, bp 1433-1416
        5′CSrevGAACGACGAACCTACGGU12338, bp 4814-4831
        Dfr-FbGGAGTTATCGGAAATGGCCCAGIntegron spacersVariableZ83311, bp 37-58
        Bla-FbGGCAATCAGCGCTTCCCGTTAF221899, bp 334-353
        Dfr-F2TTAGCCAAGACTTCGTGT dfrA15-sul1 AB113114, bp 515-532
        Sul1BGCAAGGCGGAAACCCGCGCCX12869, bp 1360-1341
        Int1AAAAACCGCCACTGCGCCGTTA intI1 1,200 12
        Int1BGAAGACGGCTGCACTGAACG
        Sul1AcGCACGTGCTGTCGAACCTTCAAY0462763, bp 38844-38865
        Aph FGGCAATCAGGTGCGACAAT kan 484AY090559, bp 12978-12997
        Aph RGTGACGACTGAATCCGGTGAAY090559, bp 13461-13441
        CAT1-FGGCATTTCAGTCAGTTG cat1 584V00622, bp 312-328
        CAT1-BCCGCCCTGCCACTCATCV00622, bp 880-896
        TET(G) 1GCTCGGTGGTATCTCTGCTC tetG 468 25
        TET(G) 2AGCAACAGAATCGGGAACAC
    ICE detection and characterization
        Int1-FGCTGGATAGGTTAAGGGCGGSXT int592 8
        Int1-BCTCTATGGGCACTGTCCACATTG
        Nint-FTACCTACAGCAGGAACGGGCSXT int258AF099172, bp 255-274
        Nint-BGCAGCACAGACACCAGACGTAF099172, bp 513-494
        FLOR-FTTATCTCCCTGTCGTTCCAGCG floR 526 22
        FLOR-2CCTATGAGCACACGGGGAGC
        TMP-FTGGGTAAGACACTCGTCATGGG dfr18 389 19
        TMP-BACTGCCGTTTTCGATAATGTGG
        SUL2-FAGGGGGCAGATGTGATCGC sul2 625AY034138, bp 16726-16706
        SUL2-BTGTGCGGATGAAGTCAGCTCC 19
        STRA-FTTGATGTGGTGTCCCGCAATGC strA 383 19
        STRA-BCCAATCGCAGATAGAAGGCAA
        strB-FGGCACCCATAAGCGTACGCC strB 470 10
        strB-RTGCCGAGCACGGCGACTACC
        dfr1-FCGAAGAATGGAGTTATCGGG dfrA1 372 22
        dfr1-BTGCTGGGGATTTCAGGAAAG
    • ↵ a Paired with In-F.

    • ↵ b Paired by different primer pair combination for mapping the integron cluster (see the text).

    • ↵ c To be paired with 5′CSrev.

    • ↵ d Primers without references were newly designed.

  • TABLE 3.

    Resistances transferred and class 1 integron cassettes identified in Vibrio strains under study

    StrainTransferred resistances in addition to common profileaClass 1 integron cassette(s)
    V. cholerae O1 582dKAN, STR, SPT, TET dfrA15, blaP1, qacH-aadA8b,g
    V. cholerae O1 583dKAN, STR, SPT, TET dfrA15, blaP1, qacH-aadA8b
    V. cholerae O1 611dKAN, STR, SPT, TET dfrA15, blaP1, qacH-aadA8b
    V. cholerae O1 1383dKAN, STR, SPT, TET dfrA15, blaP1, qacH-aadA8b
    V. cholerae O1 647KAN, STR, SPT, TET dfrA15, blaP1, qacH-aadA8b
    V. cholerae O1 817KAN, STR, SPT, TET dfrA15, blaP1, qacH-aadA8b
    V. cholerae O1 819KAN, STR, SPT, TET dfrA15, blaP1, qacH-aadA8b
    V. cholerae O1 1356KAN, STR, SPT, TET dfrA15, blaP1, qacH-aadA8b
    V. cholerae O1 1361KAN, STR, SPT, TET dfrA15, blaP1, qacH-aadA8b
    V. cholerae O1 588dERY, KAN, STR, SPT, TET dfrA15, blaP1, qacH-aadA8b
    V. cholerae O1 908ERY, KAN, STR, SPT, TET dfrA15, blaP1, qacH-aadA8b
    V. parahaemolyticus 570 dfrA15 c , g
    V. parahaemolyticus 586 dfrA15 c , g
    V. cholerae non-O1 698dNCe
    V. cholerae O1 547NCf dfrA15, blaP1, qacH-aadA8b
    • ↵ a Abbreviations: AMP, ampicillin; CHL, chloramphenicol; ERY, erythromycin; KAN, kanamycin; PEN, penicillin; STR, streptomycin; SPT, spectinomycin; SUL, sulfamethoxazole; TET, tetracycline; TMP, trimethoprim. The transferred common profile is resistance to AMP, CHL, SUL, and TMP.

    • ↵ b Plasmid located.

    • ↵ c Chromosome located.

    • ↵ d SXT integrase positive.

    • ↵ e NC, not conjugative.

    • ↵ f AMP, CHL, and TMP resistance transferred by electroporation.

    • ↵ g Confirmed by amplicon sequencing.

PreviousNext
Back to top
Download PDF
Citation Tools
New Cluster of Plasmid-Located Class 1 Integrons in Vibrio cholerae O1 and a dfrA15 Cassette-Containing Integron in Vibrio parahaemolyticus Isolated in Angola
Daniela Ceccarelli, Anna Maria Salvia, Joana Sami, Piero Cappuccinelli, Mauro Maria Colombo
Antimicrobial Agents and Chemotherapy Jun 2006, 50 (7) 2493-2499; DOI: 10.1128/AAC.01310-05

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Antimicrobial Agents and Chemotherapy article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
New Cluster of Plasmid-Located Class 1 Integrons in Vibrio cholerae O1 and a dfrA15 Cassette-Containing Integron in Vibrio parahaemolyticus Isolated in Angola
(Your Name) has forwarded a page to you from Antimicrobial Agents and Chemotherapy
(Your Name) thought you would be interested in this article in Antimicrobial Agents and Chemotherapy.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
New Cluster of Plasmid-Located Class 1 Integrons in Vibrio cholerae O1 and a dfrA15 Cassette-Containing Integron in Vibrio parahaemolyticus Isolated in Angola
Daniela Ceccarelli, Anna Maria Salvia, Joana Sami, Piero Cappuccinelli, Mauro Maria Colombo
Antimicrobial Agents and Chemotherapy Jun 2006, 50 (7) 2493-2499; DOI: 10.1128/AAC.01310-05
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
    • ABSTRACT
    • MATERIALS AND METHODS
    • RESULTS
    • DISCUSSION
    • ACKNOWLEDGMENTS
    • FOOTNOTES
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • PDF

KEYWORDS

integrons
plasmids
Vibrio cholerae O1
Vibrio parahaemolyticus

Related Articles

Cited By...

About

  • About AAC
  • Editor in Chief
  • Editorial Board
  • Policies
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • AAC Podcast
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Ethics
  • Contact Us

Follow #AACJournal

@ASMicrobiology

       

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

Print ISSN: 0066-4804; Online ISSN: 1098-6596