Article Figures & Data
Figures
- FIG. 1.
Structure of the blaVIM-2 integron from plasmid pV2GY3 of P. aeruginosa strain GY3. The locations of the primers used for PCR amplification are also shown. IR, inverted repeat; approx., approximately.
- FIG. 2.
Clustal W (version 1.83) multiple-sequence alignment of AAC(6′)-32, AAC(6′)-31 (26), and AAC(6′)-Ib′ (16). Dashes represent amino acid residues that are lacking in the indicated sequence relative to the sequence of AAC(6′)-32; asterisks indicate identical residues, colons indicate conserved substitutions, and dots indicate semiconserved substitutions.
Tables
- TABLE 1.
Primers used in this work
Primer Sequence (5′ to 3′) PCR product size (bp) Use VIM1-F GTTAAAAGTTATTAGTAGTTTATTG 799 Amplification and sequencing of blaVIM-1 and related genes VIM1-R CTACTCGGCGACTGAGC VIM2-F ATGTTCAAACTTTTGAGTAAG 801 Amplification and sequencing of blaVIM-2 and related genes VIM2-R CTACTCAACGACTGAGCG VIM-F AGTGGTGAGTATCCGACAG Sequencing of blaVIM VIM-R ATGAAAGTGCGTGGAGAC IMP1-F ATGAGCAAGTTATCTGTATTC 741 Amplification and sequencing of blaIMP-1 and related genes IMP1-R TTAGTTGCTTGGTTTTGATGG IMP2-F ATGAAGAAATTATTTGTTTTATG 741 Amplification and sequencing of blaIMP-2 and related genes IMP2-R TTAGTTACTTGGCTGTGATG INT-F CTCTCACTAGTGAGGGGC 1,010 Amplification and sequencing of intI INT-R ATGAAAACCGCCACTGCG INT-R-I CGCAGTGGCGGTTTTCAT Variable Amplification and sequencing of gene(s) between intI and blaVIM-2 VIM2-F-I CTTACTCAAAAGTTTGAACAT qacE-F GAAAGGCTGGCTTTTTCTTG 210 Amplification of qacEΔ1 qacE-R ATTATGACGACGCCGAGTC qacE-F-I CAAGAAAAAGCCAGCCTTTC Variable Amplification and sequencing of gene(s) between blaVIM and qacEΔ1 VIM-2-R-I CGCTCAGTCGTTGAGTAG PSE-1F ATGCTTTTATATAAAATGTGTG 914 Amplification and sequencing of blaPSE-1 and related genes PSE-1R TCAGCGCGACTGTGATGTA OprDF CGCCGACAAGAAGAACTAGC 1,412 Amplification and sequencing of oprD OprDR GTCGATTACAGGATCGACAG OprDF2 GCCGACCACCGTCAAATCG Sequencing of oprD - TABLE 2.
Coresistance of carbapenem-resistant isolates to β-lactam and non-β-lactam antibiotics
Antibiotic or resistance phenotype % of resistant isolates among: Statistical significance (P) Carbapenem-susceptible isolates (n = 1,014)c Carbapenem-resistant isolates (n = 236)c Ticarcillin 11 34 <0.001 Piperacillin 9 28 <0.001 Piperacillin-tazobactam 6 24 <0.001 Ceftazidime 11 46 <0.001 Cefepime 14 52 <0.001 Aztreonam 19 53 <0.001 Gentamicin 26 59 <0.001 Amikacin 9 19 <0.001 Tobramycin 9 44 <0.001 Ciprofloxacin 25 53 <0.001 Ofloxacin 32 68 <0.001 Imipenem 95d Meropenem 68 MDRa 46 Panresistantb 4 ↵ a MDR isolates are resistant to at least three of the following four antibiotics: ceftazidime, imipenem, tobramycin, and ciprofloxacin (27).
↵ b Panresistant, resistant to all antibiotics tested.
↵ c The percentages of resistant isolates shown include isolates in the intermediate and resistant CLSI categories (5).
↵ d The remaining 5% of strains were imipenem susceptible, and the MIC of meropenem for these strains was 8 μg/ml (CLSI intermediate category).
- TABLE 3.
MICs for the VIM-2-producing P. aeruginosa GY3 clinical strain, the corresponding PAO1 transformant harboring plasmid pV2GY3 with blaVIM-2 and aac(6′)-32, and the E. coli XL1-Blue strain harboring plasmid pGTAAC-32 with the cloned aac(6′)-32
Strain MIC (μg/ml) ofa: PIP PIP-TZ TIC AZT CAZ FEP MER IMP CIP TOB GEN AMK P. aeruginosa GY3 16 8 >256 2 16 16 16 >32 >32 >256 32 64 PAO1(pV2GY3) 16 16 >256 2 24 16 16 >32 0.125 64 16 48 PAO1 2 1.5 12 2 1.5 1.5 0.38 2 0.125 0.75 2 3 E. coli XL1-Blue 0.38 0.19 0.75 XL1-Blue(pGTAAC-32) 6 0.5 1.5 ↵ a MICs of piperacillin (PIP), piperacillin-tazobactam (PIP-TZ), ticarcillin (TIC), aztreonam (AZT), ceftazidime (CAZ), cefepime (FEP), meropenem (MER), imipenem (IMP), ciprofloxacin (CIP), tobramycin (TOB), gentamicin (GEN), and amikacin (AMK) were determined by Etest.
- TABLE 4.
Inactivating mutations in oprD in imipenem-resistant clones
Type of inactivating mutation Clone Description of mutation(s)a Frameshift mutation produced by 1-bp insertion or deletion LP2 Deletion of 1 bp (G) at GGGGG repeat (nt 631-635) CAS2 Deletion of 1 bp (C) at CC repeat (nt 475 and 476) VDS3 Insertion of 1 bp (G) at GGGG repeat (nt 413-416) Premature stop codon SCA1a TGG→TGA at nt 831 ALB1 TGG→TGA at nt 195 DRP2 TAT→TAA at nt 219 Partial deletion of the coding sequence LC4 13-bp deletion beginning at nt 891 RYC1 25-bp deletion beginning at nt 552 Interruption of the coding sequence by IS DEF1 1,337-bp IS at nt 1048; encodes a 361-aa putative IS4 type transposase None UNC1 Several nonunique polymorphisms in OprD: T103S, K115T, F170L, E185Q, P186G, V189T, R310E, A315G, and G425A ↵ a Nucleotide (nt) and amino acid (aa) numbers are according to the published oprD sequence of PAO1. Boldface indicates mutated nucleotides.
