Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About AAC
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • AAC Podcast
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Antimicrobial Agents and Chemotherapy
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About AAC
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • AAC Podcast
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
Mechanisms of Resistance

Fluoroquinolone-Resistant Mutants of Burkholderia cepacia

C. F. Pope, S. H. Gillespie, J. R. Pratten, T. D. McHugh
C. F. Pope
1Centre for Medical Microbiology, Royal Free and University College Medical School, Rowland Hill Street, London NW3 2QG
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
S. H. Gillespie
1Centre for Medical Microbiology, Royal Free and University College Medical School, Rowland Hill Street, London NW3 2QG
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
J. R. Pratten
2UCL Eastman Dental Institute, Gray's Inn Road, London WC1X 8LD, United Kingdom
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
T. D. McHugh
1Centre for Medical Microbiology, Royal Free and University College Medical School, Rowland Hill Street, London NW3 2QG
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: t.mchugh@medsch.ucl.ac.uk
DOI: 10.1128/AAC.00799-07
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • FIG. 1.
    • Open in new tab
    • Download powerpoint
    FIG. 1.

    Effect of topoisomerase mutations on the survival of B. cepacia in water. Survival of B. cepacia in water was not affected by mutation in gyrase subunit A or topoisomerase IV. Error bars indicate the standard errors of the means. Differences in survival are not significant.

  • FIG. 2.
    • Open in new tab
    • Download powerpoint
    FIG. 2.

    Effect of topoisomerase mutations on the survival of B. cepacia on dry surfaces. Survival of B. cepacia in water was not affected by mutation in gyrase subunit A or topoisomerase IV. Error bars indicate the standard errors of the means. Error bars are not shown if obscured by the symbol. Differences in survival are not significant.

Tables

  • Figures
  • TABLE 1.

    Primers used to amplify the QRDRs of the topoisomerase genes of B. cepacia

    GenePrimer positionsaSequence (5′-3′)Amplicon size (bp)
    gyrA 62-815′ ATCTCGATTACGCGATGAGC449
    493-5115′ GCCGTTGATCAGCAGGTT
    gyrB 1127-11465′ GAGGAAGTTGTGGCGAAGG400
    1502-15205′ AGTCTTCCTTGCCGATGC
    parC 98-1185′ ATTGGTCAGGGTCGTGAAGA229
    295-3155′ GTAGCGCAGCGAGAAATCCT
    parE 1178-11985′ CAGGGCAAGGTAGTCGAAAA380
    1557-15775′ GTGAGCAGCAAGGTCTGGAT
    • ↵ a B. cenocepacia numbering.

  • TABLE 2.

    Characteristics of fluoroquinolone-resistant B. cepacia mutants selected in vitroa

    StrainMutation rate (mutation/division)MIC (μg/μl)Selection stepSequence found in QRDRs of:Generation time [min (95% confidence interval)]P valueRelative fitness (±SEM)bP value
    gyrAgyrBparCparE
    WT1WTWTWTWT38.0 (37.06-38.94)
    F1 mutant9.6 × 10−11121stAsp87AsnWTWTWT37.0 (36.77-37.23)0.3311.01 ± 0.010.831
    F2 mutant9.6 × 10−11641stThr83IleWTWTWT37.1 (36.9-37.3)0.3771.01 ± 0.1520.868
    F3 mutant1.1 × 10−10>2562ndAsp87AsnWTSer80LeuWT43.0 (41.85-44.15)0.0040.80 ± 0.120.003
    F4 mutant6.8 × 10−10>2562ndThr83IleWTSer80LeuWT45.7 (44.2-47.2)0.0010.78 ± 0.180.002
    • ↵ a Strain F1 was isolated on 2 μg/ml ciprofloxacin (2× MIC); F2 was isolated on 6 μg/ml (6× MIC), F3 was isolated on 24 μg/ml ciprofloxacin by the use of F1 as the starting point; F4 was isolated on 128 μg/ml ciprofloxacin by the use of F2 as the starting point. The statistical significance of generation time differences is shown by a P value. WT, wild type.

    • ↵ b Competition assays were used to measure the fitness of the fluoroquinolone mutants relative to that of the susceptible parent.

PreviousNext
Back to top
Download PDF
Citation Tools
Fluoroquinolone-Resistant Mutants of Burkholderia cepacia
C. F. Pope, S. H. Gillespie, J. R. Pratten, T. D. McHugh
Antimicrobial Agents and Chemotherapy Feb 2008, 52 (3) 1201-1203; DOI: 10.1128/AAC.00799-07

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Antimicrobial Agents and Chemotherapy article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Fluoroquinolone-Resistant Mutants of Burkholderia cepacia
(Your Name) has forwarded a page to you from Antimicrobial Agents and Chemotherapy
(Your Name) thought you would be interested in this article in Antimicrobial Agents and Chemotherapy.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
Fluoroquinolone-Resistant Mutants of Burkholderia cepacia
C. F. Pope, S. H. Gillespie, J. R. Pratten, T. D. McHugh
Antimicrobial Agents and Chemotherapy Feb 2008, 52 (3) 1201-1203; DOI: 10.1128/AAC.00799-07
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
    • ABSTRACT
    • ACKNOWLEDGMENTS
    • FOOTNOTES
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • PDF

KEYWORDS

anti-infective agents
Burkholderia cepacia
ciprofloxacin
Drug Resistance, Bacterial
fluoroquinolones
mutation

Related Articles

Cited By...

About

  • About AAC
  • Editor in Chief
  • Editorial Board
  • Policies
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • AAC Podcast
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Ethics
  • Contact Us

Follow #AACJournal

@ASMicrobiology

       

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

Print ISSN: 0066-4804; Online ISSN: 1098-6596