Article Figures & Data
Figures
- FIG. 1.
Organization of the monocistronic operon containing cfr from plasmid pSCFS1 (A) and organization of the mlr operon containing the erm(B) and the cfr genes in the chromosome of MRSA isolate CM05 (B). In pSCFS1, cfr is preceded by two overlapping ORFs (shown as ORF 1 and ORF 2) and a putative promoter. In CM05, the insertion of Tn917, which carries erm(B) and its regulatory elements, disrupts ORF 1 and the putative cfr promoter. An additional 35-nucleotide sequence present in pSCFS1 immediately after ORF 2 (indicated by brackets) is absent from CM05. (C) The scheme of the RT-PCR experiment for the detection of a transcript spanning the erm(B)-cfr intergenic spacer is shown. cDNA was synthesized from primer c2, which is complementary to the 5′ proximal region of the cfr gene, and was subsequently used as a template for PCR amplification with primers e2 and c3.
- FIG. 2.
Maps of plasmids pMS2 and pLXM1 used in this study.
- FIG. 3.
Primer extension analysis of the erm(B) and cfr transcription start sites. Total RNA isolated from S. aureus RN4220 cells transformed with plasmid pMS2 was used as the template. Primers e1 and c1 were used in the experiment and were complementary to the 5′ proximal region of the erm(B) ORF (lane e1) or the 5′ proximal region of cfr ORF (lane c1). Extension products carried on pMS2 DNA were separated on a 6% denaturing polyacrylamide gel along with sequencing reactions with primer e1 (lanes G, A, T, and C). The band in lane e1 that indicates the transcription start site from the Perm promoter corresponds to a 106-nucleotide-long cDNA product. 32P-labeled 1,443-bp and 495-bp DNA markers (lane M) indicate the approximate sizes of the putative cDNA products extending from primer c1 and terminating at the erm(B) transcription start site or a putative site within the erm(B)-cfr spacer, respectively.
- FIG. 4.
Effect of Perm promoter deletion on expression of erm(B) and cfr genes. (A) Deletions engineered in plasmid pMS2, yielding plasmids pErmBΔ1, pErmBΔ2, and pErmBΔ3. (B) Disk diffusion assay. The plates carried lawns of S. aureus RN4220 cells transformed with plasmid pMS2, pLI50, or pErmBΔ1. Antibiotic disks contained 20 μg erythromycin (disks E) or 30 μg florfenicol (disks F). (C) Primer extension analysis of modification of A2058 and A2503 in 23S rRNA in cells transformed with plasmid pMS2, pLI50, or pErmBΔ1.
- FIG. 5.
Mapping of the translation start site of the cfr gene. (A) The 5′ terminal nucleotide sequence showing two putative initiator codons of the cfr gene and the mutations engineered in plasmids pMS2X1 and pMS2X2 plasmids; (B) antibiotic sensitivities of S. aureus RN4220 cells transformed with pMS2, empty vector pLI50, or plasmids pMS2X1 and pMS2X2; (C) primer extension analysis of the extent of Cfr-dependent modification of A2503 in S. aureus cells transformed with pMS2, pMS2X1, pMS2X2, or the empty vector.
- FIG. 6.
Differences in nucleotide sequences of the leader peptide ORF in transposon Tn917 [inducible erm(B)] (32) and the mlr operon [noninducible erm(B)]. The nucleotide sequence of the Tn917 erm(B) leader ORF is shown, and the nucleotide changes observed in mlr are indicated. The corresponding changes in the amino acid sequence of the encoded leader peptide are shown under the nucleotide sequence.
- FIG. 7.
(A) Relative positions of A2058, A2503, and tylosin in the nascent peptide exit tunnel of the ribosome. The segment of 23S rRNA from positions 2058 to 2061 is shown as sticks (beige). The adenine bases of the residues 2058 and 2503 are highlighted in red. Tylosin is shown in orange, with the desosamine-mycarose side chain highlighted in olive. The position of the tRNA CCA 3′ end (cyan) and the attached amino acid (blue) in the P site of the peptidyltransferase center is shown as a landmark. The figure was prepared with the PyMol program (6) on the basis of the structures of antibiotic complexes of the Haloarcula marismortui large ribosomal subunits (PDB accession numbers 1K9M and 1YI2) (10, 37). (B) The structure shown in panel A was rotated by ca. 90 degrees clockwise around the y axis to illustrate the proximity of the desosamine-mycarose side chain of tylosin to A2503. The shortest distances (in Å) between the drug and the A2503 base are indicated.
Tables
- TABLE 1.
Primers used in this study
Primer Sequence atgx1 AAATTGATTCTTAACTAGAGCAAATTGTGAAAGGCAGAAAGAAATGAATTTTAATAATAAAACAAAGTATG atgx2 CTTAACTAGAGCAAATTGTGAAAGGATGAAAGAACAGAATTTTAATAATAAAACAAAGTATGGTAAAATAC c1 TTCCTGTATTTTACCATACTTTG c2 ACATGATATAACTTCCCTG c3 CTATAATCAGGCTCATTATTACTT e1 GTCTGTTTCAAAACAGTAGATG e2 GATTGTTGAAGAAGGATTCTAC e3 GTAATTAAGAAGGAGGGATTCG e4 GTTATCTATTATTTAACGGGAGG pdel2 GCGCAAGCTTAGGTATAGGGCACCTCTAATA pdel3 GCGCAAGCTTGTATGTTTTGACTTTCGGCAC permBdel1 GGGCAAGCTTCGTCATGTTGGTATTCCAAAT RevpMS2 GGCTAATAGGGAATACATTACCA SAL2060 GTAAAGCTCCACGGGGTC SAL2507 CCAGGATGCGATGAGCCG tRNADir ATCCGGCCCCCGCAACC - TABLE 2.
Antibiotic sensitivity profiles of clinical MRSA isolate CM05 and S. aureus laboratory strain RN4220 transformed with mlr operon-expressing plasmid pMS2 or empty vector pLI50
Antibiotic MIC (μg/ml) RN4220(pLI50) RN4220(pMS2) CM05 Chloramphenicol NDa ND 64 Clindamycin <1.0 >1,024 >1,024 Erythromycin 0.5 >1,024 >1,024 Florfenicol 4 128 ND Linezolid 2 4 8 Quinupristin-dalfopristin <0.05 0.5 2 Tiamulin 1 128 512 Tylosin 2 >1,024 ND ↵ a ND, not determined.
- TABLE 4.
Extent of modification of A2058 and A2503 in clinical MRSA isolate CM05 and S. aureus RN4220 transformed with pMS2 or empty vector pLI50 before and after incubation with erythromycin or florfenicol
Strain Site % Modification after treatment witha: No treatment Erythromycin Florfenicol RN4220(pLI50) A2058 1 NDb ND A2503 0 ND ND RN4220(pMS2) A2058 12 23 20 A2503 8 11 16 CM05 A2058 34 35 32 A2503 25 27 20 - TABLE 5.
Sensitivity of S. aureus RN4220 transformed with plasmids harboring erm(B) and/or cfr to clindamycin, quinupristin-dalfopristin, tylosin, josamycin, and spiramycin
Plasmid (phenotype)a MIC (μg/ml)b CLI Q-D TYL JOS SPI pMS2 [erm(B)+cfr+] >1,024 0.39 6,000 >2,000 >4,000 pLI50 [erm(B)−cfr−] <1 <0.1 1 1 8 pLXM1 [erm(B)−cfr+] 1,024 0.39 2 64 128 pMS2X2 [erm(B)+cfr−] >1,024 <0.1 2,000 >2,000 >4,000
