Article Figures & Data
Tables
- TABLE 1.
Characteristics of class 1 integrons with the uncommon promoter sequence Pc hybrid 2 and the combinations of P2 with Pc hybrid 1 and Pc strong
Promoter Integron designation Gene cassette(s) (5′-3′) Species Location GenBank accession no. Reference or source Pc hybrid 2 In-t4 aadB, orfE, orf416, cmlA7 Klebsiella pneumoniae Plasmid pCC416 (IncA/C2) AJ704863 4 aadB, int, cmlA1 K. pneumoniae Plasmid pKPN5 (IncF; 88.6 kb) CP000650 McClelland et al., unpublished aacA1, orfGa E. coli Plasmid pCMXR1 AB061794 6 In7 bla VIM-2, aacA4 Pseudomonas aeruginosa Chromosome AM180753 8 aacA7, blaVIM-2, dfrB5, aacC-A5 P. aeruginosa Unknown DQ522233 Shevchenko and Edelstein, unpublished In70 bla VIM-1, aacA4, aphA15, aadA1 Achromobacter xylosoxidans Plasmid pAX22 (30 kb) AJ278514 14 Tn402-like oxa2, aacA4, aadA1 Uncultured bacterium Plasmid pTB11 (IncP; 68.9 kb) AJ744860 16 aacA7, catB3, aadB, oxa2, orfD Enterobacter aerogenes Plasmid pBWH301 U13880 3 aacA4 b Salmonella enterica serovar Typhimurium Plasmid pST2 S45954 10 Pc hybrid 1+P2 aadA2 E. coli Plasmid pMUR050 (IncN; 56.6 kb) AY522431 7 Pc strong+P2 In-h12 aacA7, blaVIM-12, aacA7 K. pneumoniae Plasmid p2873 (70 kb) DQ143913 12 - TABLE 2.
Oligonucleotide primers
Primer function and name Sequence (5′-3′) Usage GenBank accession no. (nt) or source Cloning and real-time PCR Int-F CGTTCCATACAGAAGCTG Cloning of the In58-G1 integron EU598463 (1-18) 3-CS AAGCAGACTTGACCTGA Cloning of the In58-G1 integron EU598463 (1625-1641) Ven-8P GTAATCTCTCTCCTGGGCT RT-PCR for blaGES-1 EU598463 (1343-1361) Ven-12 CCCCAAGGAGAGATCGT RT-PCR for blaGES-1 EU598463 (744-762) Aph-F GGAAACGTCTTGCTCGAGG RT-PCR for aphA1 X06402 (1940-1958) Aph-R ACTGAATCCGGTGAGAATGG RT-PCR for aphA1 X06402 (2480-2500) Site-directed mutagenesis P1st-Fa AACCCAGTTGACATAAGCCTGTTCGGTTCGTAAACTGTAATG Construction of the strong promoter from the weak promoter This study P1st-Ra CATTACAGTTTACGAACCGAACAGGCTTATGTCAACTGGGTT Construction of the strong promoter from the weak promoter This study P1h1-Fb GCACGAACCCAGTGGACATAAGCCTGTTCG Construction of hybrid 1 from the weak promoter (−35 box) This study P1h1-Rb CGAACAGGCTTATGTCCACTGGGTTCGTGC Construction of hybrid 1 from the strong promoter (−35 box) This study P1h2-Fb GCACGAACCCAGTTGACATAAGCCTGTTCG Construction of hybrid 2 from the weak promoter (−35 box) This study P1h2-Rb CGAACAGGCTTATGTCAACTGGGTTCGTGC Construction of hybrid 2 from the weak promoter (−35 box) This study P2ac-Fc TGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGA Construction of the P2 promoter This study P2ac-Rc TGCCCGAGGCATAGACTGTACCCCAAAAAAACAGTCA Construction of the P2 promoter This study PC-Fd GGATGAAGGCACGAACCCAGAGCTTACGAACCGAACAGTGTCCAGTAATGCAAGTAGCGTATGC Construction of a promoterless sequence upstream of the blaGES-1cassette This study PC-Rd GCATACGCTACTTGCATTACTGGACACTGTTCGGTTCGTAAGCTCTGGGTTCGTGCCTTCATCC Construction of a promoterless sequence upstream of the blaGES-1cassette This study ↵ a Underlined bases correspond to the −35 and −10 hexamers of the Pc strong promoter.
↵ b Underlined bases correspond to the −35 hexamer of the hybrid Pc promoters.
↵ c Underlined bases correspond to the insertion of three G bases in the P2 promoter sequence.
↵ d Bases in boldface type correspond to the reversed Pc weak promoter sequence. The −10 and −35 hexamers are underlined.
- TABLE 3.
Effect of integron promoter sequences on the relative amounts of blaGES-1 transcripts, β-lactamase activities, and β-lactam resistance levels in E. coli MC4100 strains carrying a plasmid-borne blaGES-1 gene cassette
Promoter Sequence at hexamer Relative amt of blaGES-1 transcriptb Hydrolysis of nitrocefin (U)c Etest MIC (μg/ml) of β-lactama −35 −10 Amx Pip Cec Cxm Caz Atm Fep Pc weak TGGACA TAAGCT 1 32 >256 2 6 8 0.75 0.047 0.032 Pc strong TTGACA TAAACT 17.0 838 >256 24 256 >256 12 0.19 0.19 Pc hybrid 1 TGGACA TAAACT 1.9 107 >256 4 8 32 1.5 0.047 0.064 Pc hybrid 2 TTGACA TAAGCT 4.6 225 >256 12 24 128 4 0.094 0.125 Pc weak+P2 TTGTTA TACAGT 4.7 198 >256 12 24 96 4 0.094 0.094 Pc strong+P2 20.5 1,030 >256 24 256 >256 16 0.25 0.19 Pc hybrid 1+P2 6.7 365 >256 16 24 256 6 0.125 0.125 Controld Not detectable <1 4 1 1.5 2 0.064 0.032 0.032 ↵ a Amx, amoxicillin; Pip, piperacillin; Cec, cefaclor; Cxm, cefuroxime; Caz, ceftazidime; Atm, aztreonam; Fep, cefepime.
↵ b Values are the means of three measurements differing by <25% and expressed as relative to that of the Pc weak promoter, set to 1.
↵ c Values are the means of three measurements differing by <10%.
↵ d Values are from E. coli MC4100 containing a promoterless blaGES-1-carrying integron sequence.