Relative Strengths of the Class 1 Integron Promoter Hybrid 2 and the Combinations of Strong and Hybrid 1 with an Active P2 Promoter

Costas C. Papagiannitsis; Leonidas S. Tzouvelekis; Vivi Miriagou

doi:10.1128/AAC.00912-08

DOI: 10.1128/AAC.00912-08

Article Figures & Data

Tables

TABLE 1.

Characteristics of class 1 integrons with the uncommon promoter sequence Pc hybrid 2 and the combinations of P2 with Pc hybrid 1 and Pc strong

Promoter	Integron designation	Gene cassette(s) (5′-3′)	Species	Location	GenBank accession no.	Reference or source
Pc hybrid 2	In-t4	aadB, orfE, orf416, cmlA7	Klebsiella pneumoniae	Plasmid pCC416 (IncA/C₂)	AJ704863	4
		aadB, int, cmlA1	K. pneumoniae	Plasmid pKPN5 (IncF; 88.6 kb)	CP000650	McClelland et al., unpublished
		aacA1, orfG^a	E. coli	Plasmid pCMXR1	AB061794	6
	In7	bla _VIM-2, aacA4	Pseudomonas aeruginosa	Chromosome	AM180753	8
		aacA7, bla_VIM-2, dfrB5, aacC-A5	P. aeruginosa	Unknown	DQ522233	Shevchenko and Edelstein, unpublished
	In70	bla _VIM-1, aacA4, aphA15, aadA1	Achromobacter xylosoxidans	Plasmid pAX22 (30 kb)	AJ278514	14
	Tn402-like	oxa2, aacA4, aadA1	Uncultured bacterium	Plasmid pTB11 (IncP; 68.9 kb)	AJ744860	16
		aacA7, catB3, aadB, oxa2, orfD	Enterobacter aerogenes	Plasmid pBWH301	U13880	3
		aacA4 ^b	Salmonella enterica serovar Typhimurium	Plasmid pST2	S45954	10
Pc hybrid 1+P2		aadA2	E. coli	Plasmid pMUR050 (IncN; 56.6 kb)	AY522431	7
Pc strong+P2	In-h12	aacA7, bla_VIM-12, aacA7	K. pneumoniae	Plasmid p2873 (70 kb)	DQ143913	12

↵ a aacA1 and orfG occur in the same cassette.
↵ b Only the first gene cassette has been characterized.

TABLE 2.

Oligonucleotide primers

Primer function and name	Sequence (5′-3′)	Usage	GenBank accession no. (nt) or source
Cloning and real-time PCR
Int-F	CGTTCCATACAGAAGCTG	Cloning of the In58-G1 integron	EU598463 (1-18)
3-CS	AAGCAGACTTGACCTGA	Cloning of the In58-G1 integron	EU598463 (1625-1641)
Ven-8P	GTAATCTCTCTCCTGGGCT	RT-PCR for bla_GES-1	EU598463 (1343-1361)
Ven-12	CCCCAAGGAGAGATCGT	RT-PCR for bla_GES-1	EU598463 (744-762)
Aph-F	GGAAACGTCTTGCTCGAGG	RT-PCR for aphA1	X06402 (1940-1958)
Aph-R	ACTGAATCCGGTGAGAATGG	RT-PCR for aphA1	X06402 (2480-2500)
Site-directed mutagenesis
P1st-F^a	AACCCAGTTGACATAAGCCTGTTCGGTTCGTAAACTGTAATG	Construction of the strong promoter from the weak promoter	This study
P1st-R^a	CATTACAGTTTACGAACCGAACAGGCTTATGTCAACTGGGTT	Construction of the strong promoter from the weak promoter	This study
P1h1-F^b	GCACGAACCCAGTGGACATAAGCCTGTTCG	Construction of hybrid 1 from the weak promoter (−35 box)	This study
P1h1-R^b	CGAACAGGCTTATGTCCACTGGGTTCGTGC	Construction of hybrid 1 from the strong promoter (−35 box)	This study
P1h2-F^b	GCACGAACCCAGTTGACATAAGCCTGTTCG	Construction of hybrid 2 from the weak promoter (−35 box)	This study
P1h2-R^b	CGAACAGGCTTATGTCAACTGGGTTCGTGC	Construction of hybrid 2 from the weak promoter (−35 box)	This study
P2ac-F^c	TGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGA	Construction of the P2 promoter	This study
P2ac-R^c	TGCCCGAGGCATAGACTGTACCCCAAAAAAACAGTCA	Construction of the P2 promoter	This study
PC-F^d	GGATGAAGGCACGAACCCAGAGCTTACGAACCGAACAGTGTCCAGTAATGCAAGTAGCGTATGC	Construction of a promoterless sequence upstream of the bla_GES-1cassette	This study
PC-R^d	GCATACGCTACTTGCATTACTGGACACTGTTCGGTTCGTAAGCTCTGGGTTCGTGCCTTCATCC	Construction of a promoterless sequence upstream of the bla_GES-1cassette	This study

↵ a Underlined bases correspond to the −35 and −10 hexamers of the Pc strong promoter.
↵ b Underlined bases correspond to the −35 hexamer of the hybrid Pc promoters.
↵ c Underlined bases correspond to the insertion of three G bases in the P2 promoter sequence.
↵ d Bases in boldface type correspond to the reversed Pc weak promoter sequence. The −10 and −35 hexamers are underlined.

TABLE 3.

Effect of integron promoter sequences on the relative amounts of bla_GES-1 transcripts, β-lactamase activities, and β-lactam resistance levels in E. coli MC4100 strains carrying a plasmid-borne bla_GES-1 gene cassette

Promoter	Sequence at hexamer		Relative amt of bla_GES-1 transcript^b	Hydrolysis of nitrocefin (U)^c	Etest MIC (μg/ml) of β-lactam^a
Promoter	−35	−10	Relative amt of bla_GES-1 transcript^b	Hydrolysis of nitrocefin (U)^c	Amx	Pip	Cec	Cxm	Caz	Atm	Fep
Pc weak	TGGACA	TAAGCT	1	32	>256	2	6	8	0.75	0.047	0.032
Pc strong	TTGACA	TAAACT	17.0	838	>256	24	256	>256	12	0.19	0.19
Pc hybrid 1	TGGACA	TAAACT	1.9	107	>256	4	8	32	1.5	0.047	0.064
Pc hybrid 2	TTGACA	TAAGCT	4.6	225	>256	12	24	128	4	0.094	0.125
Pc weak+P2	TTGTTA	TACAGT	4.7	198	>256	12	24	96	4	0.094	0.094
Pc strong+P2			20.5	1,030	>256	24	256	>256	16	0.25	0.19
Pc hybrid 1+P2			6.7	365	>256	16	24	256	6	0.125	0.125
Control^d			Not detectable	<1	4	1	1.5	2	0.064	0.032	0.032

↵ a Amx, amoxicillin; Pip, piperacillin; Cec, cefaclor; Cxm, cefuroxime; Caz, ceftazidime; Atm, aztreonam; Fep, cefepime.
↵ b Values are the means of three measurements differing by <25% and expressed as relative to that of the Pc weak promoter, set to 1.
↵ c Values are the means of three measurements differing by <10%.
↵ d Values are from E. coli MC4100 containing a promoterless bla_GES-1-carrying integron sequence.