Article Figures & Data
Figures
- FIG. 1.
Percentage of killed C. albicans cells in total of 2 × 107 cells/ml following 24-h exposure to farnesol (0 to 300 μM), as determined by MTS metabolic assay. Error bars indicate standard errors of the means.
- FIG. 2.
Representative two-dimensional gels of extracted proteins from C. albicans grown in the presence of 0 (0F), 40 (40F), or 200 (200F) μM farnesol, demonstrating differential protein expression. Forty-five protein spots (marked with numbered arrows) displayed consistent alterations upon farnesol treatment. Panels A to D represent the corresponding sections marked on the two-dimensional gels. Information on the identities and functions of these spots are listed in Table 2. MW, molecular weight.
- FIG. 3.
Representative confocal scanning laser fluorescence images of farnesol-treated and untreated C. albicans cells, revealing the presence of (A) ROS accumulation, indicated by green fluorescence, and necrotic or dead cells, indicated by red fluorescence; (B) mitochondrial degradation in the farnesol-exposed cells, indicated by green fluorescence, with healthy mitochondria appearing as red aggregates; and (C) activation of intracellular caspases in the farnesol-exposed cells, indicated by green fluorescence. Minimal patchy fluorescence was observed in the cells treated with 40 μM farnesol, with increasing fluorescence seen with increasing concentrations of farnesol. The amount of farnesol is indicated in each panel by a number and the letter “F.” The bar represents 20 μm.
- FIG. 4.
TUNEL assay showing a dose-dependent increase in apoptosis, indicated by appearance of green fluorescence in farnesol-treated C. albicans cells compared to untreated cells. The amount of farnesol is indicated in each panel by a number and the letter “F.” The bar represents 20 μm.
Tables
- TABLE 1.
Primer sequences used in qPCRa
Primer Sequence (5′→3′) Fragment size (bp) ACT1 f1 ATCAAGGTATCATGGTTGGTATGG 100 ACT1 r2 TGTTCAATTGGGTATCTCAAGGTC 100 RPP2B f3 ACTTAGCTGCTTACTTATTGTTAG 143 RPP2B r4 GTCTTTACCTTCCAAATCTTTCA 143 MCAI f3 AGGGTATAACCAAGGTTACG 200 MCAI r4 CAGAAGGTCTATTGTATTGTCC 200 ↵ a All primers were optimized at 58°C and showed efficiencies between 90 and 110%.
- TABLE 2.
Proteins down- or upregulated with farnesola
Protein regulation and amount of farnesol (μM) Protein spot Protein (gene) Function MW pI No. of peptide matches % Protein score/ confidence interval (%) NCBI nr database accession no. Downregulation 40 2a Putative stress response protein (DDR48) Damage response 22602 4.27 11 100 68483600 2b Translational elongation factor 1β (TEF1) Protein synthesis 2494267 4.25 3 100 2494267 5 Riboflavin synthase; hypothetical Ca019-11507 (RIB5) Involved in riboflavin synthesis 30917.3 5.8 8 100 68467869 6 Phosphoglycerate mutase; hypothetical CaO19.8522 (GPM1-2) Glycolysis; changes with drug exposure 27437.5 5.79 15 100 68469783 7 G-beta-like protein; hypothetical Ca019-9606 (ASC1) Unknown 23622.1 6.3 4 100 68487301 8 Similar to mammalian aldo/keto reductase; hypothetical CaO19.6757 (GRE3) Involved in stress response 33095.2 6.17 7 100 68472117 9 Glyceraldehyde-3-phosphate dehydrogenase (TDH1) Glycolysis; changes with drug exposure 35926.7 6.61 15 100 68472227 10 Enolase; hypothetical Ca019-8025 (ENO) Glycolysis 47202.5 5.54 13 100 68488457 200 17 ATP synthase subunit D; hypothetical CaO19.10301 (ATP7) Mitochondrial; catalyzes ATP synthesis 19364.1 6.19 8 100 68488805 18 NADH:quinone oxidoreductase; hypothetical CaO19.11095 (CQR2) Enzyme complex of the respiratory chain 21714.2 6.51 5 100 68483141 19 Heat shock protein 60 (HSP60) Mitochondrial; involved in proteins imported into the mitochondrion 60378.6 5.22 16 100 68485963 20 Orthologous to carboxymethylenebutenolidase; hypothetical CaO19.2966 (YDL086W) Hydrolase enzyme 28828.4 5.84 4 100 68468813 22 Glyceraldehyde-3-phosphate dehydrogenase (TDH1-3) Glycolysis 35926.7 6.61 18 100 68472227 24 Dihydroxy acid dehydratase (ILV3) Mitochondrion; involved in branched amino acid synthesis 63462.9 6.2 12 100 68467901 26 Pyruvate kinase (PYK1) Glycolysis 55757.7 6.54 23 100 68482226 27 S-adenosylmethionine synthase; hypothetical CaO19.8272 (SAM2) Methionine metabolism 42465.8 5.64 16 100 68484437 Upregulation 40 23 Putative mitochondrial aconitate hydratase (ACO1) Tricarboxylic acid cycle 84632.7 5.96 24 100 68479387 88 Coproporphyrinogen III oxidase (HEM13) Mitochondrion; involved in heme biosynthesis 37089.4 5.66 15 100 68490312 89 Branched chain amino acid transaminase; hypothetical CaO19.6994 (BAT1) Involved in branched amino acid synthesis 40894 5.89 11 100 68482781 90a Alcohol dehydrogenase; hypothetical CaO19.3997 (ADH3) Functions in formaldehyde metabolism 46499.6 8.26 19 100 68468132 91 Catalase A (CTA1) Reactive oxygen metabolism 54945.2 6.18 16 100 68474218 92 6-Phosphogluconate dehydrogenase; hypothetical CaO19.12491 (GND1) Plays a critical role in protecting cells from oxidative stress 57164.1 6.14 19 100 68467359 93 Pyruvate decarboxylase (CDC19/PYK1) Glycolysis 62750 5.39 18 100 68480872 96 Heat shock protein 70; hypothetical CaO19.12447 (SSA1) Molecular chaperone; involved in response to environmental stress 70445 5.06 24 100 68467277 97 Alanine/arginine aminopeptidase; hypothetical CaO19.12664 (APE2) Protein degradation 107584.4 5.63 37 100 68491573 98 Heat shock protein 90 homologue; hypothetical CaO19.6515 (HSP90) Molecular chaperone; involved in response to environmental stress 80773.2 4.81 28 100 68469132 99a Aryl-alcohol dehydrogenase; hypothetical CaO19.1048 (CAD4) Involved in drug resistance 39539.7 6.84 16 100 6325169 200 57 Heat shock protein 90 (HSP90) Molecular chaperone; involved in response to environmental stress 23899.4 4.33 1 63 68475757 58 Putative Rho protein GDP dissociation factor (RDI1) Involved in reorganization of actin cytoskeleton 22947.9 5.15 7 100 68465635 59 Putative mitochondrial aconitate dehydrogenase (ACO1) Required for tricarboxylic acid cycle and mitochondrial genome maintenance 84632.7 5.96 28 100 68479387 60 Heat shock protein 60 (HSP60) Mitochondria; oxidative stress response 60378.6 5.22 1 50 68485963 61 Aldose reductase (GRE3) Induced by oxidative stress 42602.9 7.05 17 100 68470494 62 Coproporphyrinogen III oxidase (HEM13) Mitochondria; involved in heme biosynthesis 37089.4 5.66 10 100 68490312 66 GTP binding protein; homologue to human Ranp (GSP2) Involved in the maintenance of nuclear organization, RNA processing 25148.7 6.22 6 100 6324759 67 Manganese superoxide dismutase Involved in defense against ROS 14782.7 8.04 2 46 60760051 69 Mitochondrial 2-enoyl thioester reductase Required for respiration and maintenance of mitochondrial function 38645.3 6.36 13 99.99 68486065 70 Putative aspartate aminotransferase (AAT21) Aspartate metabolism 49035.3 8.61 17 100 68482311 72 Glutathione reductase (GLR1) Oxidative stress 57190.1 7.18 10 100 55294642 76 Acetyl-CoA hydrolase/transferase (ACH1) Involved in acetyl-CoA pathway 58172.5 6.42 8 98.53 68482646 78 Phosphoglycerate mutase; hypothetical CaO19.8669 (GPM1) Glycolysis 30678.1 7.19 5 99.98 68484809 80 Outer mitochondrial membrane porin; hypothetical CaO19.1042 (POR1) Required for the maintenance of mitochondrial osmotic stability and membrane permeability 29748.5 8.5 12 100 68484582 81 NADH-cytochrome b5 reductase (MCR1) Involved in resistance against oxidative stress 33555.6 8.54 1 48 68490698 ↵ a Proteins identified by two-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis and MALDI-TOF MS as being differentially expressed in cells exposed to increasing concentrations of farnesol and unexposed cells. Acetyl-CoA, acetyl coenzyme A.
- TABLE 3.
Percentages of cells demonstrating mitochondrial degradation, ROS accumulation, or caspase activationa
Farnesol conc (μM) Mitochondrial degradation ROS accumulation Caspase activity % Dead cells 0 <1 0 <1 0 40 90 26 5 13 100 93 80 13 20 200 95 65 84 35 ↵ a Indicate occurrences of apoptosis followed by death upon exposure to increasing concentrations of farnesol.
Supplemental material
Files in this Data Supplement:
- Supplemental file 1
-
Figure S1 showing gels performed on C. albicans protein samples extracted from cultures grown with or without methanol.
Zipped PDF document, 200K.
- Supplemental file 1
-
Figure S1 showing gels performed on C. albicans protein samples extracted from cultures grown with or without methanol.
