Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About AAC
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • AAC Podcast
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Antimicrobial Agents and Chemotherapy
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About AAC
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • AAC Podcast
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
Mechanisms of Resistance

First Description of an RND-Type Multidrug Efflux Pump in Achromobacter xylosoxidans, AxyABM

Julien Bador, Lucie Amoureux, Jean-Marie Duez, Anthony Drabowicz, Eliane Siebor, Catherine Llanes, Catherine Neuwirth
Julien Bador
1Department of Bacteriology, University Hospital of Dijon, BP 37013, 21070 Dijon Cedex, France
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Lucie Amoureux
1Department of Bacteriology, University Hospital of Dijon, BP 37013, 21070 Dijon Cedex, France
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Jean-Marie Duez
1Department of Bacteriology, University Hospital of Dijon, BP 37013, 21070 Dijon Cedex, France
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Anthony Drabowicz
1Department of Bacteriology, University Hospital of Dijon, BP 37013, 21070 Dijon Cedex, France
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Eliane Siebor
1Department of Bacteriology, University Hospital of Dijon, BP 37013, 21070 Dijon Cedex, France
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Catherine Llanes
2Department of Bacteriology, University of Franche-Comte, Faculty of Medicine, F-25030 Besançon, France
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Catherine Neuwirth
1Department of Bacteriology, University Hospital of Dijon, BP 37013, 21070 Dijon Cedex, France
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: catherine.neuwirth@chu-dijon.fr
DOI: 10.1128/AAC.00341-11
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • Fig. 1.
    • Open in new tab
    • Download powerpoint
    Fig. 1.

    Amino acid sequence similarities (%). MFP, membrane fusion protein (AxyA and homologues); RNDt, RND transporter (AxyB and homologues); OMP, outer membrane protein (AxyM and homologues); A.x.A8, A. xylosoxidans A8; A.p., Achromobacter piechaudii ATCC 43553; B.b., Bordetella bronchiseptica RB50; P.a., Pseudomonas aeruginosa PAO1.

Tables

  • Figures
  • Table 1.

    MICs of 24 antibiotics for AXX-A and AXX-A-ΔP (axyB::Tic)

    AntibioticMIC (μg/ml) for:
    AXX-AAXX-A-ΔP
    Ticarcillin0.25>256
    Ticarcillin-clavulanic acid0.50.5
    Cephalothin2412
    Cefuroxime>256>256
    Cefotetan>25632
    Cefoxitin>256128
    Ceftriaxone≥25612
    Cefotaxime>25612
    Ceftazidime41.5
    Cefixime>25632
    Cefepime1616
    Aztreonam>25616
    Imipenem11
    Meropenem0.0940.094
    Nalidixic acid246
    Norfloxacin84
    Ofloxacin21
    Levofloxacin0.750.38
    Ciprofloxacin0.750.5
    Tobramycin1616
    Amikacin≥256≥256
    Tigecycline44
    Colistin44
    Chloramphenicol126
  • Table 2.

    Primers used in the study

    PrimerNucleotide sequence (5′–3′)
    MexB2-FAACGTGCAGATTTCCTCCGG
    MexB2-RTGTACCTGGGCGAACAGTAC
    INA-axyB-2FGGGGAATTCTCTATCGCCAGTTCTCCATCAa
    INA-axyB-2RGGGAAGCTTGCGCACGTACCATTTGTCCAb
    AL-BAP1-F1TGTACCTGTTCCTGCAGAAC
    M14FcCCAGGGTTTTCCCAGTCACGA
    M14RcGCGGATAACAATTTCACACAGGA
    AL-BAP1-R1AAGTACACGTCGTTGGACAG
    RT-INA-R0ACCATGTCGCCATCCTTGTT
    RT-INA-F1GTGTTCATCCCGATGGCGTT
    • ↵a The EcoRI restriction site introduced into the primer is underlined.

    • ↵b The HindIII restriction site introduced into the primer is underlined.

    • ↵c Primer designed in pINAP1.

PreviousNext
Back to top
Download PDF
Citation Tools
First Description of an RND-Type Multidrug Efflux Pump in Achromobacter xylosoxidans, AxyABM
Julien Bador, Lucie Amoureux, Jean-Marie Duez, Anthony Drabowicz, Eliane Siebor, Catherine Llanes, Catherine Neuwirth
Antimicrobial Agents and Chemotherapy Sep 2011, 55 (10) 4912-4914; DOI: 10.1128/AAC.00341-11

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Antimicrobial Agents and Chemotherapy article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
First Description of an RND-Type Multidrug Efflux Pump in Achromobacter xylosoxidans, AxyABM
(Your Name) has forwarded a page to you from Antimicrobial Agents and Chemotherapy
(Your Name) thought you would be interested in this article in Antimicrobial Agents and Chemotherapy.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
First Description of an RND-Type Multidrug Efflux Pump in Achromobacter xylosoxidans, AxyABM
Julien Bador, Lucie Amoureux, Jean-Marie Duez, Anthony Drabowicz, Eliane Siebor, Catherine Llanes, Catherine Neuwirth
Antimicrobial Agents and Chemotherapy Sep 2011, 55 (10) 4912-4914; DOI: 10.1128/AAC.00341-11
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
    • ABSTRACT
    • TEXT
    • ACKNOWLEDGMENTS
    • FOOTNOTES
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • PDF

Related Articles

Cited By...

About

  • About AAC
  • Editor in Chief
  • Editorial Board
  • Policies
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • AAC Podcast
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Ethics
  • Contact Us

Follow #AACJournal

@ASMicrobiology

       

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

Print ISSN: 0066-4804; Online ISSN: 1098-6596