Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About AAC
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • AAC Podcast
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Antimicrobial Agents and Chemotherapy
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About AAC
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • AAC Podcast
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
Epidemiology and Surveillance

Wide Dissemination of Pseudomonas aeruginosa Producing β-Lactamase blaKPC-2 Gene in Colombia

Gaelle Cuzon, Thierry Naas, Maria-Virginia Villegas, Adriana Correa, John P. Quinn, Patrice Nordmann
Gaelle Cuzon
1Service de Bactériologie-Virologie, INSERM U914 Emerging Resistance to Antibiotics, Hôpital de Bicêtre, Assistance Publique-Hôpitaux de Paris, 94275 Le Kremlin-Bicêtre, Faculté de Médecine Paris-Sud, Paris, France
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Thierry Naas
1Service de Bactériologie-Virologie, INSERM U914 Emerging Resistance to Antibiotics, Hôpital de Bicêtre, Assistance Publique-Hôpitaux de Paris, 94275 Le Kremlin-Bicêtre, Faculté de Médecine Paris-Sud, Paris, France
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: thierry.naas@bct.aphp.fr
Maria-Virginia Villegas
2International Center for Medical Research and Training, Cali, Colombia
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Adriana Correa
2International Center for Medical Research and Training, Cali, Colombia
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
John P. Quinn
3Pfizer Global Research and Development, Groton, Connecticut
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Patrice Nordmann
1Service de Bactériologie-Virologie, INSERM U914 Emerging Resistance to Antibiotics, Hôpital de Bicêtre, Assistance Publique-Hôpitaux de Paris, 94275 Le Kremlin-Bicêtre, Faculté de Médecine Paris-Sud, Paris, France
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI: 10.1128/AAC.00297-11
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • Fig. 1.
    • Open in new tab
    • Download powerpoint
    Fig. 1.

    Dendrogram of pulsed-field gel electrophoresis data (SpeI digests) showing genetic relatedness between the 10 KPC-producing reference isolates. M, molecular weight.

  • Fig. 2.
    • Open in new tab
    • Download powerpoint
    Fig. 2.

    (A) Plasmid extractions from cultures of the different isolates by the Kieser method. (B) Southern hybridization carried out with an internal probe for the blaKPC-2 gene. Lane 1, P. aeruginosa PA-1; lane 2, P. aeruginosa PA-2; lane 3, P. aeruginosa PA-3; lane 4, P. aeruginosa PA-4; lane 5, P. aeruginosa PA-5; lane 6, P. aeruginosa PA-6; lane 7, P. aeruginosa PA-7; lane 8, P. aeruginosa PA-8; lane 9, P. aeruginosa PA-9; lane 10, P. aeruginosa PA-10; lane 11, E. coli 50192 harboring four (7-, 48-, 66-, and 154-kb) plasmids. C, chromosome.

  • Fig. 3.
    • Open in new tab
    • Download powerpoint
    Fig. 3.

    Schematic representations of genetic structures surrounding the blaKPC gene in different P. aeruginosa isolates. (A) P. aeruginosa PR280 harboring blaKPC-5 from Puerto Rico (19); upstream of the blaKPC-5 gene, a portion of the transposable element Tn5563, previously described in plasmid pRA2 from P. alcaligenes, was found. (B) Novel structure characterized in PA-2 from Colombia. (C) Structure of Tn4401b. The dotted rectangles indicate the common regions between the different structures. Horizontal arrows indicate genes and their corresponding transcription orientations. Gray triangles represent the left inverted repeat (IRL) and right inverted repeat (IRR) of Tn4401. Small and empty triangles represent the inverted repeats of ISKpn6 and ISKpn7. Target site duplications (TSDs) are indicated above the sequence. Small black triangles above the sequence represent the primers listed in Table 2.

Tables

  • Figures
  • Table 1.

    Origin, structure of Tn4401, other β-lactamases, plasmid analysis, pulsotype, and sequence type of the P. aeruginosa isolates

    IsolateOrigin in ColumbiaYr of isolationSite of isolationLocationPCR and sequencing result (Tn4401 homology)blaKPC-2-positive plasmidBacterial isolate characteristic
    NameSize (kb)TransformantPulsotypeSequence type
    blaKPC-2TnpAISKPN6ISKPN7ECaPAb
    PA-1Medellin2006Bronchial secretionTertiary care centerKPC-2+++pCOL45++A1ST308
    PA-2Bogota2006StoolUnknownKPC-2−+−pPA-213++BST1006
    PA-3Barranquiila2006Bronchial secretionIntensive care unitKPC-2+++pPA-360−−CST1060
    PA-4Medellin2006BoneGeneral wardcKPC-2+++pPA-445++A2ST308
    PA-5Medellin2006Surgical woundGeneral wardKPC-2+++pPA-545++A2ST308
    PA-6Medellin2006Surgical woundGeneral wardKPC-2+++pPA-645++A1ST308
    PA-7Medellin2006UrineGeneral wardKPC-2+++pPA-745++A1ST308
    PA-8Medellin2006Tracheal aspirateIntensive care unitKPC-2+++pPA-845++A1ST308
    PA-9Cali2007Peritoneal fluidGeneral wardKPC-2+++−−−−DST235
    PA-10Pereira2010UrineIntensive care unitKPC-2+++−−−−EST235
    • ↵a Transformants into E. coli (EC) DH10B.

    • ↵b Transformants into P. aeruginosa (PA) KG2505.

    • ↵c General ward: patients hospitalized for surgical or medical disease.

  • Table 2.

    Primers used in this study

    Name of primerFig. 2 lane no.Sequence (5′-3′)Reference
    KPC-A1CTGTCTTGTCTCTCATGGCC11
    KPC-B2CCTCGCTGTGCTTGTCATCC11
    3098U3TGACCCTGAGCGGCGAAAGC11
    4914L4GAAGATGCCAAGGTCAATGC11
    TnpA-178U5CTTGCAGATCGGCTACTTCAThis study
    TnpA-1198U6CGCCATCTTCGTCCACTGTAThis study
    TnpA-2537L7GCCCTGCGTCATTTCCTTCAThis study
    ISKpn7-24U8CCCACCCCAGCGAAGTAAAACThis study
    ISKpn7-1916L9GACCCACTTTACCCCTGAATThis study
    ISKpn6-82U10CGTCGGCGCCAAGGATACCAThis study
    ISKpn6-1429L11ATCTGCTGCCCCCTTCTCTGThis study
    141R-612TCACCGGCCCTCACCTTTGG11
    EcoRI-out13CACCCGACCTGGACGAACTA11
    Delta SHVaAAGATCCACTATCGCCAGCAG4
    Delta SHVbATTCAGTTCCGTTTCCCAGCGG4
    Pre-TEM1GTATCCGCTCATGAGACAATA4
    Pre-TEM2TCTAAAGTATATATGAGTAAACTTGGTCTG4
    CTX-MACGCTTTGCGATGTGCAG4
    CTX-MBACCGCGATATCGTTGGT4
    VIM-BATGGTGTTTGGTCGCATATC11
    VIM-FTGGGCCATTCAGCCAGATC1
    IMP-2004AACAYGGYTTGGTDGTTCTTG1
    IMP-2004BGGTTTAAYAAAACAACCACC1
    OXA-9ATTCGTTTCCGCCACTCTCCC4
    OXA-9BACGAGAATATCCTCTCGTGC4
PreviousNext
Back to top
Download PDF
Citation Tools
Wide Dissemination of Pseudomonas aeruginosa Producing β-Lactamase blaKPC-2 Gene in Colombia
Gaelle Cuzon, Thierry Naas, Maria-Virginia Villegas, Adriana Correa, John P. Quinn, Patrice Nordmann
Antimicrobial Agents and Chemotherapy Oct 2011, 55 (11) 5350-5353; DOI: 10.1128/AAC.00297-11

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Antimicrobial Agents and Chemotherapy article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Wide Dissemination of Pseudomonas aeruginosa Producing β-Lactamase blaKPC-2 Gene in Colombia
(Your Name) has forwarded a page to you from Antimicrobial Agents and Chemotherapy
(Your Name) thought you would be interested in this article in Antimicrobial Agents and Chemotherapy.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
Wide Dissemination of Pseudomonas aeruginosa Producing β-Lactamase blaKPC-2 Gene in Colombia
Gaelle Cuzon, Thierry Naas, Maria-Virginia Villegas, Adriana Correa, John P. Quinn, Patrice Nordmann
Antimicrobial Agents and Chemotherapy Oct 2011, 55 (11) 5350-5353; DOI: 10.1128/AAC.00297-11
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
    • ABSTRACT
    • TEXT
    • ACKNOWLEDGMENTS
    • FOOTNOTES
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • PDF

Related Articles

Cited By...

About

  • About AAC
  • Editor in Chief
  • Editorial Board
  • Policies
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • AAC Podcast
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Ethics
  • Contact Us

Follow #AACJournal

@ASMicrobiology

       

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

Print ISSN: 0066-4804; Online ISSN: 1098-6596