Molecular Analyses of TEM Genes and Their Corresponding Penicillinase-Producing Neisseria gonorrhoeae Isolates in Bangkok, Thailand

Shu-ichi Nakayama; Chanwit Tribuddharat; Sasiprapa Prombhul; Ken Shimuta; Somporn Srifuengfung; Magnus Unemo; Makoto Ohnishi

doi:10.1128/AAC.05665-11

DOI: 10.1128/AAC.05665-11

Article Figures & Data

Figures

Tables
Additional Files

Open in new tab
Download powerpoint
Fig 1
MAMA-PCR for bla_TEM-135 detection. (A) The TEM PCR primer set (TEM-F and TEM-R), which can amplify a 231-bp amplicon from bla_TEM-1 and bla_TEM-135, and the MAMA-PCR primer set, specific for bla_TEM-135 (MAMA-F and MAMA-R), are shown schematically with arrows. The sequence of primer MAMA-R (middle) and the corresponding regions from bla_tem135 (top) and bla_tem1 (bottom) are also shown. (B) The PCR results for the Japanese penicillinase-producing N. gonorrhoeae (PPNG) TEM-135 and PPNG TEM-1 isolates, which were used as controls in all PCRs, are presented.
Open in new tab
Download powerpoint
Fig 2
Minimum spanning tree analysis of multilocus sequence typing (MLST) STs observed in penicillinase-producing N. gonorrhoeae (PPNG) isolates cultured in Thailand in 2005 to 2007. Numbers beside the circles denote ST. Solid lines, dashed lines, and dotted lines show the interrelationship of “single-locus variant,” “double-locus variant,” and “triple-locus variant,” respectively. The types directly or indirectly connected through single- or double-locus-variant relationships were judged to form one cluster. Each cluster is shaded gray. Sizes of circles reflect the numbers of isolates belonging to each type (for details, see text and tables). The only PPNG TEM-135 isolate belonging to cluster A (ST7822) is marked with an asterisk, and its plasmid type is given.
Open in new tab
Download powerpoint
Fig 3
Molecular characterization of penicillinase-producing N. gonorrhoeae PPNG TEM-135 isolates. (A) Sequence types revealed by multilocus sequence typing (MLST) and N. gonorrhoeae multiantigen sequence typing (NG-MAST) are shown, along with por and tbpB alleles. (B and C) Neighbor-joining clustering showing similarity of por alleles (B) and tbpB alleles (C) from PPNG TEM-135 isolates.

Table 1
Primers used in the MAMA-PCR for detection of bla_TEM-135 and the TEM-PCR for detection of both bla_TEM-1 and bla_TEM-135
Primer Primer sequence (5′ to 3′) Position
MAMA-F GCATCTTACGGATGGCATGAC 327-347
MAMA-R^a TGTTGCCATTGCTGCAGGGG 558-539
TEM-F GTCGCCCTTATTCCCTTTTTTG 22-43
TEM-R TAGTGTATGCGGCGACCGAG 284-268
↵a Binds only bla_TEM-135.

Table 2

MLST sequence type and plasmid type of PPNG isolates cultured in Thailand in 2005 to 2007^a

No. of isolates	MLST		No. of isolates with plasmid type^c:
No. of isolates	ST	Cluster^b	Africa	Asia	Toronto/Rio
55	1588	A	53	1	1
5	8780	A	5
4	1903	A	4
4	8774	A	4
2	1584	A	2
2	1921	A	2
2	8779	A	2
1	7827	A	1
1	8145	A	1
1	8776	A	1
1	8783	A	1
1	8777	A	1
2	7823	A		2
1	1600	A		1
1	7822	A		1 (1)^d
1	8781	A		1
2	8775	B		2
2	8782	B	2
4	8778	C			4 (4)
1	1582	C			1 (1)
1	8136	C			1 (1)
1	8143	C			1 (1)
1	8784	C			1 (1)
96		TOTAL	79	8 (1)	9 (8)

↵a MLST, multilocus sequencing typing (5); PPNG, penicillinase-producing Neisseria gonorrhoeae.
↵b Clusters were defined by the minimum spanning tree in Fig. 2.
↵c Plasmid typing was determined by a multiplex PCR (12).
↵d The number of PPNG TEM-135 isolates is shown in parentheses.

Additional Files

Figures
Tables

Supplemental material

Files in this Data Supplement:

Supplemental file 1 - Table S1, molecular typing of penicillinase-producing N. gonorrhoeae isolated in Thailand.
PDF file, 120K.