E1210, a New Broad-Spectrum Antifungal, Suppresses Candida albicans Hyphal Growth through Inhibition of Glycosylphosphatidylinositol Biosynthesis

Antifungals.E1210 was synthesized by Eisai Co. (Tokyo, Japan). Fluconazole was extracted from fluconazole tablets (Pfizer Japan Inc., Tokyo, Japan), and micafungin was obtained in vials (Astellas Pharma Inc., Tokyo, Japan). Amphotericin B was purchased from Sigma-Aldrich Co. (St. Louis, MO). Compounds were dissolved in dimethyl sulfoxide (DMSO) and diluted with an appropriate medium to yield a DMSO concentration of 1%. All of the solutions were prepared on the day of use.

Cloning of fungal GWT1 and human PIG-W genes.Cloning of GWT1 genes from C. albicans and A. fumigatus was described in our previous report (63). Briefly, the C. albicans GWT1 (CaGWT1) gene was isolated from a clinical isolate in our laboratory. The amino acid sequence of the CaGWT1 product is 100% identical to that of the GWT1 protein from C. albicans SC5314 strain (XP_712813.1; locus tag Cao19.6884) in the NCBI database. A. fumigatus GWT1 (AfGWT1) was isolated from a commercial cDNA library purchased from Stratagene Corp. (La Jolla, CA). We found one amino acid substitution, I197T, between our AfGWT1 product and AFUA_1G14870 gene product in the NCBI database (accession no. XP_752856.1). DNA fragments containing the human PIG-W gene were amplified from human genomic DNA using primers hGW044F (GCCCAAAGTTCTGCTCTGAAATCTAGT) and hGW043R (ATGGTTAACACTGTTGCCAAAAGCACA) and then cloned into pT7-Blue vector. The DNA sequence of human PIG-W which we cloned was identical to that of the PIG-W gene deposited in the NCBI database (NM_178517.3).

Plasmid construction.CaGWT1 was inserted into the multiple-copy plasmid YEp352GAPII and the single-copy plasmid pRS316 (42), and the resultant newly constructed plasmids were designated YEp-Ca and pRS-Ca, respectively. Likewise, the AfGWT1 and human PIG-W genes were cloned into plasmids YEp352GAPII and pRS316, and the resultant plasmids were designated YEp-Af, pRS-Af, YEp-hum, and pRS-hum. Plasmid YEp provides high levels of Gwt1p expression and pRS supports lower levels of Gwt1p expression in Saccharomyces cerevisiae. Plasmid introduction into the diploid strain WDG2 of S. cerevisiae (63) and heterozygous deletion of GWT1 were performed using a Yeast Maker yeast transformation kit (Clontech Laboratories, Mountain View, CA), and the haploid cells deleted for GWT1 gene and complemented by orthologous GWT1 or PIG-W protein expression were segregated from the transformed WDG2 cells. We obtained gwt1 knockout cells complemented by YEp-Ca, YEp-Af, YEp-hum, pRS-Ca, and pRS-Af; however, we found that pRS-hum does not rescue growth defects caused by Gwt1p depletion. S. cerevisiae strains used in this study are listed in Table 1.

Other organism and media.C. albicans strains were provided by the Medical Mycology Research Center, Chiba University (Chiba, Japan), and the Graduate School of Medicine, Gifu University (Gifu, Japan). A total of 36 strains were clinically isolated in Japanese hospitals from 2000 to 2005, and eight strains were isolated from blood, 6 from sputum, 2 from pharyngeal mucosa, 16 from female genitals, and 4 from other clinical sites. Strain IFM49971 was mainly used for each assay described below. Escherichia coli IFO12734 and Staphylococcus aureus IFO12732 were provided by the Institute for Fermentation (Osaka, Japan).

Synthetic defined medium without uracil [SD(−Ura)] [yeast nitrogen base without amino acids (Becton Dickinson Company, Sparks, MD) supplemented with 0.5% glucose and 0.077% −Ura DO supplement (Clontech Laboratories)] was used for S. cerevisiae growth. For C. albicans, Sabouraud dextrose broth (SDB; Becton Dickinson Company), YPS agar (1% yeast extract, 2% Bacto peptone, 2% sucrose, and 1.2% Bacto agar), and RPMI 1640 medium (Nissui Pharmaceutical Co., Tokyo, Japan) buffered with 0.165 M 3-morpholinopropane sulfonic acid (MOPS) (pH 7.0) (MOPS–RPMI 1640) were used, and for germ tube formation assay of C. albicans, yeast nitrogen base with amino acids supplemented with 0.5% glucose (YNB), Spider medium (31), Lee's medium (28), YPD broth (Becton Dickinson Company) supplemented with 10% fetal calf serum (FCS), and yeast nitrogen base without amino acids but supplemented with 2.5 mM N-acetylglucosamine (35) were also used. Mueller-Hinton broth (MHB; Becton Dickinson Company) was used for bacteria.

MIC determinations.The MICs of all compounds were determined using a broth microdilution method in accordance with the guidelines presented in Clinical and Laboratory Standards Institute (CLSI) documents M27-A3 for yeasts (9) and M07-A7 for bacteria (8). Inoculum sizes were 1 × 10³ for S. cerevisiae and C. albicans and 5 × 10⁵ cells/ml for bacteria. After 48 h at 30°C for S. cerevisiae and at 35°C for C. albicans, or after 18 h at 35°C for bacteria, MICs were read. The MICs of E1210 were defined as the lowest concentration at which a prominent decrease (≥50% of the growth of the compound-free control) in growth turbidity relative to the turbidity of the compound-free control at 660 nm was observed. The MICs of other compounds were read in accordance with the CLSI guidelines.

Preparation of yeast membrane fractions.The membrane fractions of S. cerevisiae GWT1 disruptant harboring YEp-Ca, YEp-Af, or YEp-hum were used as the enzyme sources because the Gwt1p activity in membrane fractions of C. albicans and A. fumigatus cells was low. Yeast cells grown in SD(−Ura) medium were then harvested by centrifugation, washed twice in 50 mM Tris-HCl buffer (pH 7.5) containing 2 mM MgCl₂ (TM buffer), and suspended in TM buffer with 0.1% 2-mercaptoethanol. The cell suspensions were mixed with an equal weight of glass beads (diameter, 0.5 mm), and were homogenized with a cell disruptor [Multi Beads Shocker, model MB601(S); Yasui Kikai Co., Osaka, Japan] operating at 2,500 rpm with 12 cycles of 30-s bursts and 30-s intervals at 0°C. The unbroken cells and glass beads were removed by centrifugation at 3,000 × g for 5 min at 4°C. The supernatants were further centrifuged at 20,000 × g for 20 min at 4°C, and the pellets were washed with TM buffer. The pellets were resuspended in TM buffer containing 10% glycerol and used as the membrane fraction. The protein concentration was estimated by a Coomassie Plus—The Better Bradford assay kit (Pierce Biotechnology Inc., Rockford, IL) with bovine serum albumin as the standard. The membrane fractions were diluted with TM buffer to 1 mg of protein/ml. They were stored at −80°C until use.

In vitro assay for the inositol acylation in GPI biosynthesis.Inositol acylation was assayed by the method of Umemura et al. (64) with slight modifications. Membrane fractions (70 μg protein) were incubated in TM buffer containing 2 mM MnCl₂, 10 μM nikkomycin Z (Sigma-Aldrich), 21 μg/ml tunicamycin (Sigma-Aldrich), 0.5 mM dithiothreitol, and 0.925 kBq of UDP-[¹⁴C]-N-acetylglucosamine (GlcNAc) (specific activity, 10.7 GBq/mmol; PerkinElmer Life & Analytical Sciences, Boston, MA) for 20 min at 30°C. Then, an excess of unlabeled UDP-GlcNAc (1.94 mM) and compounds were added and further incubated for 20 min at 30°C. Palmitoyl coenzyme A (palmitoyl-CoA) (0.1 mM) (Sigma-Aldrich) was added as an acyl donor, and incubation was continued for 2 h at 30°C. The reaction was stopped by adding 1 ml CHCl₃-CH₃OH (1:1, vol/vol). The sample was then incubated at room temperature for about 90 min with shaking (at about 1,400 rpm) and centrifuged at 2,140 × g for 5 min at 25°C, after which the supernatant was separated and saved. The pellet was extracted by 0.5 ml CHCl₃-CH₃OH-H₂O (10:10:3, vol/vol/vol). The pooled lipid extracts were evaporated to dryness under nitrogen gas at 37°C. The lipid was resuspended in 0.5 ml butanol and 0.5 ml H₂O to desalt. After separation by centrifugation, the butanol phase was collected, and then the H₂O phase was re-extracted with 0.5 ml butanol. The butanol phase was pooled, washed once with 1 ml butanol-saturated H₂O, and then evaporated to dryness under nitrogen gas at 37°C. The dried lipids were dissolved in 50 μl CHCl₃-CH₃OH (2:1, vol/vol) and applied to a Silica Gel 60 plate (Merck KGaA, Darmstadt, Germany). Thin-layer chromatography plates were developed in CHCl₃-CH₃OH-H₂O (65:25:4, vol/vol/vol) (10). In this solvent system, the order of migration of PI-GlcNAc and PI-GlcN is the reverse of that achieved in the CHCl₃–CH₃OH–1 M NH₄OH (10:10:3) solvent system which Umemura et al. used (64). Then attached to BAS-MS2040 imaging plates (Fujifilm Co., Tokyo, Japan) for 2 to 5 days for autoradiography. Radioactive products were detected and analyzed with a BAS2500 imaging analyzer (Fujifilm), and the photostimulated luminescence counts of the acylated phosphatidylinositol glucosamine [PI (acyl)-GlcN] zones were quantified. The positions of the radioactive PI (acyl)-GlcN zones were identified as those that were not detected in the absence of palmitoyl-CoA. Each experiment was carried out three times. The inhibition rate (percent) of the inositol acylation of GPI at each compound concentration was calculated, and the mean 50% inhibitory concentration (IC₅₀) and 95% confidence interval (CI) were determined.

Phosphatidylinositol-specific phospholipase C (PI-PLC) treatment of radiolabeled lipids was conducted according to the method of Umehara et al. (64).

Als1p protein levels.To estimate the amount of Als1p expressed on the cell surface, the compound-treated cells were retained on the filters, and the relative Als1p levels on the cell surface of cells were measured with an enzyme-linked immunosorbent assay (ELISA). C. albicans IFM49971 was grown in SDB for 3 days at 25°C without shaking, to obtain a saturated culture containing synchronized cells (20). The culture was centrifuged at 800 × g for 5 min at 4°C to pellet the cells, and the pellet was then resuspended in MOPS–RPMI 1640 medium at a concentration of 5 × 10⁶ cells/ml. Since Fu et al. (15) showed that the Als1p expression on the surface of C. albicans cells was induced after incubation for 1 h in MOPS–RPMI 1640, C. albicans cells were incubated for 1 h at 35°C in MOPS–RPMI 1640 that contained serial fourfold dilutions of E1210, micafungin, or fluconazole on a filter plate (MultiScreen HTS 96-well filtration plate; Millipore Corp., Billerica, MA). Compound-free controls (controls) and C. albicans-free controls (blanks) were included. Little change in cell counts was observed after treatment with E1210, micafungin, or fluconazole for 1 h. The concentrations used were 1/4×MIC, 1×MIC, 4×MIC and 16×MIC of each compound. The assay for each concentration for each compound was performed in sextuplicate and repeated three times. After incubation for 1 h, the medium was removed by using a vacuum manifold. The C. albicans cells remaining on the filter were washed three times by aspiration with phosphate-buffered saline (PBS) and then were assayed by ELISA. For the ELISA, 4-fold-diluted Block Ace solution (Snow Brand Milk Products Co., Hokkaido, Japan) was used as the blocking agent, anti-Als1 rabbit polyclonal antibody (Sawady Technology Co., Tokyo, Japan) was used as the primary antibody, and anti-rabbit IgG, horseradish peroxidase (HRP)-linked donkey antibody (GE Healthcare UK Ltd., Buckinghamshire, England) was used as the secondary antibody. The amount of Als1p was estimated based on peroxidase activity, which was assayed on filter plate after the addition of 0.1 ml SureBlue Reserve TMB microwell peroxidase substrate (KPL Inc., Gaithersburg, MD) as the substrate. The plates were incubated for 15 min at room temperature, and the reaction was terminated by adding 0.1 ml TMB stop solution (KPL). The reaction mixture was filtered, and the absorbance of each filtrate was measured at 450 nm. The Als1p expression rate (percentage of the control) was then calculated. The expression levels of Rho1p, a membrane protein without a GPI anchor, on the cell surface were likewise evaluated using the ELISA method.

The Als1p levels in crude extracts of C. albicans cells were also determined. The cells were incubated for 1 h at 35°C in the presence of E1210. After incubation, the cultures were centrifuged at 1,000 × g for 10 min at 4°C and the pellets were suspended in 50 mM potassium phosphate buffer (pH 7.4) containing a protease inhibitor cocktail for fungi (Sigma-Aldrich). The cell suspensions were mixed with an equal weight of glass beads and were homogenized with the cell disruptor. The unbroken cells and glass beads were then removed by centrifugation. The supernatants were obtained as crude extracts. The amount of Als1 protein in the crude extracts was also measured by an ELISA. Anti-Als1 antibody was used as the capture antibody, and anti-C. albicans, HRP-conjugated rabbit antibody (ViroStat Inc., Portland, ME) was used as the secondary antibody. An ELISA of each concentration was conducted in duplicate, and the final values were expressed as the means of three determinations. Protein concentration was estimated in order to standardize the amount of Als1p.

Adherence and germ tube formation in C. albicans.Cells grown in SDB for 3 days at 25°C were resuspended to concentrations of 5 × 10⁶ and 1 × 10⁶ cells/ml in MOPS–RPMI 1640 for the adherence assay and the germ tube formation assay, respectively. C. albicans cells were incubated at 35°C in MOPS–RPMI 1640 that contained serial 2-fold dilutions of E1210, fluconazole, micafungin, or amphotericin B. The number of C. albicans cells that adhered to the wells of 96-well polystyrene plates was determined using the crystal violet staining assay (1). Compound-free controls (controls) and C. albicans-free controls (blanks) were included. The plates were incubated for 1 h and 4 h for the adherence assay and the germ tube formation assay, respectively. The latter assay is based on the observation that C. albicans germ tubes adhere to plastic surfaces (1, 62). However, incubation for >1 h in MOPS–RPMI 1640 induces germ tube formation in C. albicans cells; it is therefore difficult to compare the inhibitory effects of compounds on C. albicans adherence with and without the potential to inhibit germ tube formation in C. albicans cells after >1 h incubation. Thus, to evaluate the inhibitory effects of compounds on the adherence of C. albicans cells, they were incubated for 1 h, at which time point no distinct cell elongation was apparent (see Fig. 7). In addition, to investigate the adherence potential of C. albicans cells that were not cultured in MOPS–RPMI 1640, plates that included only controls and blanks were also prepared and were immediately subjected to the procedures described below.

After incubation, the plates were processed by the procedures of Brayman and Wilks (5). The medium in the plates was discarded by inverting the plates. The remaining C. albicans cells in the wells were sterilized by immersion in 70% ethanol, which was discarded, and then 0.2 ml of 0.25% sodium dodecyl sulfate (SDS) (Wako Pure Chemical Industries, Osaka, Japan) was added to each well. The SDS was discarded, and the plates were washed three times by immersion in ion-exchanged water. The C. albicans cells that attached to the wells were stained for 20 min at room temperature with 0.1 ml of 0.02% crystal violet (Muto Pure Chemicals Co., Tokyo, Japan) diluted with PBS. The crystal violet solution was removed by inverting the plates. They were then washed three times with water, once with 0.25% SDS, and twice again with water. After the plates were dried, 0.2 ml isopropanol containing 40 mM HCl and 0.05 ml of 0.25% SDS were added to the wells, and the absorbance at 590 nm was measured using a 660-nm reference. The absorbance of each concentration for each compound was measured in duplicate, and the final values were expressed as the means of three determinations. The adherence rate and the germ tube formation rate (percentage of the control) were each calculated, and the mean IC₅₀ and 95% CI were calculated. An additional plate was prepared for each assay, and after incubation, 0.05 ml of 3% glutaraldehyde solution (Wako Pure Chemical Industries) was added to the culture wells to fix the cells. After fixation, the C. albicans cells were observed by phase-contrast microscopy and the microscopic images of culture wells were each recorded. Effects of E1210 on germ tube formation were also evaluated in YNB, Spider medium, Lee's medium, YPD supplemented with 10% FCS, and yeast nitrogen base without amino acids but supplemented with 2.5 mM N-acetylglucosamine.

Colony morphology.Cells grown in SDB for 3 days at 25°C were resuspended and diluted to 1 × 10⁴ cells/ml in physiological saline. Approximately 100 cells were mixed with molten YPS agar that contained serial 2-fold dilutions of E1210 and plated. Plates were incubated for 48 h at 35°C, and colonies were microscopically observed.

Biofilm formation in C. albicans.The 96-well microtiter plates were pretreated with 0.1 ml of FCS for 24 h at 35°C and washed twice in PBS. C. albicans IFM49971 grown in SDB for 3 days at 25°C without shaking was resuspended in MOPS–RPMI 1640 supplemented with 10% FCS. Then, 0.1 ml C. albicans cell suspension (1 × 10⁶ cells/ml) was added. The plates were incubated for 1 h at 35°C. The medium was discarded by inverting the plates. The plates were washed three times with PBS to remove any unattached planktonic cells. Compound dilutions in MOPS–RPMI 1640 supplemented with 10% FCS were dispensed into a microtiter plate. Compound-free controls (controls) and C. albicans-free controls (blanks) were included. After incubation for 24 h at 35°C, the plates were stained using safranin. Safranin is capable of staining exopolymeric material structures (53, 54); therefore, biofilm formation was evaluated by determining the biofilm density after safranin staining. The biofilms were stained for 15 min at room temperature by adding 50 μl of 1% safranin solution (Waldeck GmbH & Co. KG, Münster, Germany). The safranin solution was carefully removed by aspiration, and the wells were washed carefully three times with PBS. Then, 0.2 ml DMSO was added to the wells and mixed gently. Absorbance at 492 nm was measured using a 660-nm reference. Each concentration for each compound was performed in duplicate, and the final values were expressed as the means of three determinations. The biofilm density (% of control) was calculated, and the mean IC₅₀ and the 95% CI were also calculated.

MICs for sessile forms (SMICs) of C. albicans were also determined according to the method of Jacobson et al. (24). C. albicans strains grown in yeast nitrogen base medium were suspended in MOPS–RPMI 1640 at a concentration of 1 × 10⁷ CFU/ml. Each suspension (0.1 ml) was added to the 96-well microtiter plate and incubated at 35°C. After incubation for 24 h, the suspensions were discarded, and the wells were rinsed three times with PBS and filled with 0.1 ml of compound dilutions in MOPS–RPMI 1640. Microtiter plates were incubated at 35°C for an additional 48 h. Then, media were discarded, and wells were rinsed three times with PBS. The metabolic activity of C. albicans cells was measured using the XTT [2,3-bis(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide; Sigma-Aldrich] reduction assay, in which a colorimetric change should correlate directly with the metabolic activity of the C. albicans cells (4, 48). XTT was prepared as a saturated solution at 0.5 mg/ml in PBS. Prior to the assay, stock XTT solution was thawed, and menadione (10 mM in acetone; Sigma-Aldrich) was added to give a final concentration of 25 μM. XTT-menadione solution was then added to the plates, and the plates were incubated in the dark for 30 min at 35°C. The colorimetric change was measured at 492 nm using a 660-nm reference. The SMICs were defined as the lowest concentrations associated with a 50% reduction in absorption compared to the absorption level for the control. MICs for planktonic forms were determined using broth microdilution (9).

Scanning electron microscopy.A four-well slide (Sonic Seal Slide Wells; Nalge Nunc International Corp., Rochester, NY) was pretreated with 1 ml of FCS for 24 h at 35°C and washed twice with PBS. Then, the C. albicans cells (1 × 10⁶ cells) suspended in MOPS–RPMI 1640 were added, and the slide was incubated for 1 h at 35°C. The medium was then discarded, and the slide was washed three times with PBS to remove unattached planktonic cells. Then, 1 ml of MOPS–RPMI 1640 supplemented with 10% FCS containing E1210 (0.008 μg/ml) was added. After incubation for 24 h at 35°C, 1 ml of 2% glutaraldehyde solution was added to the culture wells to fix the cells. After 1 h of fixation, the C. albicans cells in biofilms were carefully rinsed four times with PBS and then placed in 1% osmium tetroxide for 1 h. The specimens were subsequently dehydrated in a series of ethanol washes, treated with isoamyl acetate overnight, and finally dried by a critical-point drying method. The specimens were then coated with gold. After the specimens were processed, they were examined under a scanning electron microscope (Type JSM-820; JEOL Ltd., Tokyo, Japan).

Statistical analysis.Statistical analyses were performed using the SAS software package, version 8.2 (SAS Institute Japan Ltd., Tokyo, Japan), for the Als1p and Rho1p expression levels.

Nucleotide sequence accession numbers.The CaGWT1 and AfGWT1 genes were deposited in GenBank under accession numbers AB092481 and AB092482, respectively.