Article Figures & Data
Figures
- Fig 1
Comparative analysis of IncFIIK plasmids pKPN3 (CP000648), pKPN4 (CP000649), pKpQIL (GU595196), and pBK32179 (JX430448). Light blue shading denotes shared regions of homology (>99.5% nucleotide similarity). Open reading frames (ORFs) are indicated by arrows and colored based on predicted gene function. Orange arrows indicate plasmid scaffold regions. The genes associated with the tra locus are indicated by green arrows, and replication-associated genes are denoted as dark blue arrows. Antimicrobial resistance genes are indicated by red arrows, while copper, mercury, and silver resistance genes are shown by light blue arrows. Other genes in the accessory region are indicated by yellow arrows. Small black arrowheads beneath the plasmids indicate the locations of primers used for PCR screening of pBK32179-like plasmids. Primer sequences used for PCRs were as follows: 1, repA-F (CTTCACGTCCCGTTTTGATT), 2, repA-R (CGCTTCAGCGCTTCTTTATC) (657 bp); 3, hel-F (ATGGTGGGGGAAAAATTCAT), 4, 4401-R (GTCACGTCAAGCGAGGAGTC) (1,996 bp); 5, repA2-F (ACGTTAAGATCACCGGTTCG), and 6, repA2-R (TAGGCTGACTGCACCAGATG) (271 bp). pBK32179-like plasmids are positive by targets of primer sets 1/2, 3/4, and 5/6, while pKpQIL-, pKPN4-, and pKPN3-like plasmids are positive only by PCRs of primer sets 1/2 and/or 5/6 but not set 3/4.
