Mechanisms of Resistance

Role of Non-Active-Site Residue Trp-93 in the Function and Stability of New Delhi Metallo-β-Lactamase 1

Asad U. Khan, M. Tabish Rehman
DOI: 10.1128/AAC.01194-15

ABSTRACT

New Delhi metallo-β-lactamase-1 (NDM-1) is expressed by various members of Enterobacteriaceae as a defense mechanism to hydrolyze β-lactam antibiotics. Despite various studies showing the significance of active-site residues in the catalytic mechanism, there is a paucity of reports addressing the role of non-active-site residues in the structure and function of NDM-1. In this study, we investigated the significance of non-active-site residue Trp-93 in the structure and function of NDM-1. We cloned blaNDM-1 from an Enterobacter cloacae clinical strain (EC-15) and introduced the mutation of Trp-93 to Ala (yielding the Trp93Ala mutant) by PCR-based site-directed mutagenesis. Proteins were expressed and purified to homogeneity by affinity chromatography. The MICs of the Trp93Ala mutant were reduced 4- to 8-fold for ampicillin, cefotaxime, ceftazidime, cefoxitin, imipenem, and meropenem. The poor hydrolytic activity of the Trp93Ala mutant was also reflected by its reduced catalytic efficiency. The overall catalytic efficiency of the Trp93Ala mutant was reduced by 40 to 55% (the Km was reduced, while the kcat was similar to that of wild-type NDM-1 [wtNDM-1]). Heat-induced denaturation showed that the ΔGDo and Tm of Trp93Ala mutant were reduced by 1.8 kcal/mol and 4.8°C, respectively. Far-UV circular dichroism (CD) analysis showed that the α-helical content of the Trp93Ala mutant was reduced by 2.9%. The decrease in stability and catalytic efficiency of the Trp93Ala mutant was due to the loss of two hydrogen bonds with Ser-63 and Val-73 and hydrophobic interactions with Leu-65, Val-73, Gln-123, and Asp-124. The study provided insight into the role of non-active-site amino acid residues in the hydrolytic mechanism of NDM-1.

INTRODUCTION

Dissemination of multidrug-resistant NDM-1 in hospitals and community settings poses a serious threat to human health (1). NDM-1 was first reported in 2009 from a Swedish patient who traveled to India for medical treatment and acquired a urinary tract infection (2). NDM-1 has been found in different bacterial strains isolated on all continents, thus presenting a high risk of a worldwide pandemic among Enterobacteriaceae and causing global concern (3). The dissemination of NDM-1-positive strains has been reported in developing as well as industrialized nations, such as the United States, Canada, Sweden, the United Kingdom, Austria, Belgium, France, Netherlands, Germany, Australia, Japan, Oman, Pakistan, Bangladesh, and China, as well as in Africa (3). NDM-1 is a member of the Amber molecular class B metallo-β-lactamases (MBL) and belongs to Bush-Jacoby functional class 3a (4, 5). Like all the members of the MBL superfamily, NDM-1 also shares a highly conserved MBL fold, which is characterized by a four-layered αβ/βα fold with a wide and deep active site (6). The active site of NDM-1 is characterized by two bound zinc ions: Zn1 adopts tetrahedral coordination formed by His-120, His-122, His-189, and Asp-124, while Zn2 has a trigonal pyramidal conformation involving Cys-208, His-250, and Asp-124 (6). A water molecule or a hydroxide moiety acts as a nucleophile during β-lactam hydrolysis and is located between these 2 Zn ions. The relevance of several active-site residues in the catalytic activity of NDM-1 has been studied in detail (7). However, there are only a few reports on the involvement of non-active-site residues in the functional versatility of NDM-1 (8). It is hypothesized that amino acid residues flanking the active site of β-lactamases may also play a crucial role in modulating its catalytic efficiency (9). In this regard, the hydrophobic amino acid residues, like Leu-65, Met-67, Pro-68, Val-73, Gly-69, Phe-70, Val-73, and Trp-93, and alkyl moieties of Leu-209, Ile-210, Lys-211, Asp-212, Lys-214, Ala-215, Lys-216, and Asn-220 have been predicted to be significant in determining overall activity of NDM-1 and hence could be potential targets for the design of specific inhibitors. We studied the role of a non-active-site residue, Trp-93, in the structure and function of NDM-1 by changing it to Ala-93.

Previously, we reported the dissemination of blaNDM-1 in Enterobacter cloacae (EC-15) and Klebsiella pneumoniae (KP-12) isolates of clinical origin from Aligarh Hospital in north India (10, 11). In this study, E. cloacae clinical strain EC-15 (GenBank accession no. JN860195.1) was used to clone blaNDM-1 into the pQE-2 vector, and the generated plasmid (pNDM-1) was used as a template to mutate Trp-93 to Ala by PCR-based site-directed mutagenesis. Further, we investigated the significance of Trp-93 in the structure and function of NDM-1 using microbiological, biochemical, and biophysical approaches.

MATERIALS AND METHODS

Bacterial strain, antibiotics, and other reagents.Escherichia coli DH5α cells were used for molecular cloning of blaNDM-1 and blaNDM-1 Trp93Ala, while E. coli BL21(λDE3) cells were used for MIC determination and gene expression. Ampicillin, cefotaxime, ceftazidime, cefepime, imipenem, meropenem, and aztreonam were purchased from Sigma (St. Louis, MO), while nitrocefin was purchased from Calbiochem (USA). 4-(2-Pyridylazo)resorcinol (PAR) was purchased from Sigma-Aldrich (USA). Isopropyl-β-d-thiogalactopyranoside (IPTG) was purchased from Roche (Basel, Switzerland). Other reagents and chemicals were of analytical grade.

Cloning of blaNDM-1 and the Trp93Ala mutant.E. cloacae (EC-15) was used to clone blaNDM-1 into the pQE-2 vector using forward primer ATATCATATGGAAATCCGCCCGACG, containing an NdeI restriction site, and reverse primer ATATAAGCTTGCGCAGCTTGTCG, containing a HindIII restriction site. The Trp93Ala mutation in blaNDM-1 was introduced by PCR-based site-directed mutagenesis using GATACCGCCGCAACCGATG (forward primer) and CATCGGTTGCGGCGGTATC (reverse primer). The PCR conditions used were as follows: denaturation at 94°C for 7 min, followed by 35 cycles of 94°C (30 s), 55°C (30 s), and 71°C (60 s) and a final extension of 7 min at 72°C. The cloning vector (pQE-2) and PCR products were digested with NdeI and HindIII restriction enzymes and ligated using T4 DNA ligase (Qiagen) according to the manufacturer's protocol. The heat shock method was used to transform competent E. coli DH5α cells with the ligated product; the cells were then plated on LB agar supplemented with ampicillin (100 μg/ml) and incubated at 37°C overnight. Positive colonies were confirmed by restriction digestion and DNA sequencing by standard procedures.

Expression and purification of NDM-1 and theTrp93Ala mutant.Proteins were expressed in E. coli BL21(λDE3) cells and purified by affinity chromatography as described previously (12). The purified protein was dialyzed at 4°C against 50 mM HEPES buffer (pH 7.0) supplemented with 250 mM NaCl and 100 μM ZnCl2. The purity of the purified protein was more than 95%, as checked by SDS-PAGE, and the concentration was determined spectrophotometrically using a molar extinction coefficient of 27,880 M−1 cm−1 at 280 nm. The zinc content of the purified proteins was determined by PAR assay (13). We found that the wild-type NDM-1 and its Trp93Ala mutant had 1.93 ± 0.2 and 1.87 ± 0.3 Zn(II) ions, respectively.

MIC determination.MICs were determined on E. coli BL21(λDE3) cells by the broth microdilution method, and the results were interpreted according to CLSI guidelines (14, 15). E. coli BL21(λDE3) cells harboring blaNDM-1 or the blaTrp93Ala mutant were treated with different concentrations of antibiotics ranging from 0.5 to 1,024 mg/liter in a series of 2-fold dilutions. E. coli BL21(λDE3)/pQE-2 was used as a negative control. The bacteria were diluted to 1 × 106 CFU/ml by adding Luria-Bertani broth containing 100 μg/ml of ampicillin and 100 μM ZnCl2. The antibiotics used to determine MICs were ampicillin, cefotaxime, ceftazidime, cefoxitin, imipenem, and meropenem.

Steady-state enzyme kinetics.Steady-state enzyme kinetics was determined by directly monitoring the initial velocities of appearance or disappearance of chromophores of the following antibiotics: nitrocefin (Δε486 = 15,000 M−1 cm−1), ampicillin (Δε235 = −900 M−1 cm−1), cefotaxime (Δε264 = −7,250 M−1 cm−1), ceftazidime (Δε265 = −10,300 M−1 cm−1), cefoxitin (Δε270 = −8,380 M−1 cm−1), imipenem (Δε295 = −11,500 M−1 cm−1), meropenem (Δε297 = −10,940 M−1 cm−1), and aztreonam (Δε318 = −660 M−1 cm−1). All the experiments were carried out in 50 mM HEPES buffer (pH 7.0) containing 250 mM NaCl and 100 μM ZnCl2 at 30°C as described previously (12). Bovine serum albumin (BSA; 20 μg/ml) was added in the dilution buffer to prevent denaturation of NDM-1 and Trp93Ala mutant proteins. We found that BSA at the concentration used in the experiment did not show any effect on the hydrolytic ability of NDM-1 or the Trp93Ala mutant on various substrates. Initial velocities were calculated and fitted to the Michaelis-Menten equation to deduce kinetic parameters (kcat and Km) using the following equations: v=Vmax[S]Km+[S]1 kcat=Vmax[E]2 where v and Vmax are the initial and maximum velocities, respectively, [S] is the substrate concentration, and [E] is the enzyme concentration.

Far-UV CD spectra measurement.The far-UV CD spectra of NDM-1 and the Trp93Ala mutant were recorded on a Jasco J-815 spectropolarimeter (Jasco International, Tokyo, Japan) equipped with a Peltier-type temperature controller (PTC-423S/15) as described previously (16). The concentrations of NDM-1 and the Trp93Ala mutant were both 5 μM, and the path length used was 0.1 cm. The observed ellipticity (θobs; in degrees) was converted to mean residue ellipticity (MRE) in degrees per square centimeter per decimole using the following equation: MRE=θobs10×n×C×l3 where θobs is the observed ellipticity (in degrees), C is the molar concentration of protein, n is the number of amino acid residues, and l is the path length (in centimeters).

Helical content was calculated from the MRE values at 222 nm (MRE222) using the following relations as described by Chen et al. (17). %α−helix=(MRE222−2,34030,300)×1004

Thermal stability determination.The thermal stabilities of NDM-1 and the Trp93Ala mutant were measured by following the change in MRE222 in the temperature range of 25 to 90°C with a 1°C/min heating rate as described previously, with minor modifications (18). Each heat-induced transition curve was analyzed for Tm (midpoint of denaturation) and ΔHm (enthalpy change at Tm) using a nonlinear least-square method as described by Robertson and Murphy (19). The heat-induced denaturation curve was also analyzed for the fraction denatured (fD) and the change in Gibbs free energy (ΔGD) as reported previously (20).

RESULTS AND DISCUSSION

NDM-1 and its natural variants have gained attention worldwide due the versatile hydrolytic activity of NDM-1 on almost all the β-lactam antibiotics. The problem is compounded by the continuous evolution of NDM enzymes and thus the lack of an effective common inhibitor. To date, 16 variants of the NDM enzyme have been reported from different places around the globe in different bacterial species (www.lahey.org/Studies/other.asp; accessed 20 May 2015). A number of studies have focused on the significance of active-site residues like Asp-124, Lys-211, and Asn-220 in substrate recognition and catalytic mechanism (7, 21). However, on close analysis of the structure of natural variants of NDM, it is clear that the replacement of amino acid residues located outside the active site can also contribute significantly to determining the broad specificity of the enzyme. For example, NDM-4 and NDM-5 have been reported to possess enhanced catalytic activities toward carbapenems and some cephalosporins (22, 23). NDM-4 evolved from NDM-1 by mutation of non-active-site amino acid residue Met-154 to Leu (22). Likewise, NDM-5 evolved from NDM-4 by mutation of Val-88 to Leu in addition to a mutation of Met-154 to Leu (23). As evident from the natural variants of NDM-1, non-active-site amino acid residues play an important role in the evolution of NDM enzyme. Thus, a detailed biochemical and biophysical investigation is needed to completely understand the significance of such residues in the structure and function and hence evolution of NDM enzymes.

In the present study, we explored the significance of non-active-site residue Trp-93 in the structure and function of NDM-1 by mutating it to Ala. The residue Trp-93 is located outside the active site and does not make any physical contact with the nucleophile (water or hydroxide ion) or zinc ions (Fig. 1). Steady-state enzyme kinetics was determined for the purified enzymes, and the results are presented in Table 1. The Km and kcat values indicate that both wild-type NDM-1 and the Trp93Ala mutant can hydrolyze all the tested antibiotics except aztreonam (Table 1). The Km values of the Trp93Ala mutant were increased (i.e., affinity was decreased), while kcat values were slightly decreased with various β-lactam substrates. In particular, the affinity of the Trp93Ala mutant was reduced considerably for cefotaxime, cefoxitin, and meropenem. Moreover, the decrease in the affinity (Km) of the Ala-93 mutant toward various β-lactam substrates was drastic compared to the decrease in its catalytic activity (kcat). Thus, on changing of Trp-93 to Ala, the overall catalytic efficiency (kcat/Km) was reduced by 40 to 55% for all the antibiotics tested owing to the poor affinity of the enzyme. These results showed that Trp-93 plays a significant role in facilitating the accessibility of β-lactam antibiotics by the active site of NDM-1. Our results are well supported by the X-ray crystal structures of NDM-1 with meropenem and ampicillin, which clearly show that Trp-93 along with Leu-65, Val-73, and Met-67 was involved in stabilizing the hydrolyzed antibiotic through hydrophobic interaction with the core of β-lactam ring (24, 25). Similarly, the nuclear magnetic resonance (NMR) structures of NDM-1 and cephalosporins show that Trp-93 was positioned perpendicular to the five- or six-membered ring placed close to the cleaved amide bond and stabilized the complex through hydrophobic interactions (26). In another study, Chen et al. also elucidated the significance of non-active-site residue Tyr-229 in the catalytic proficiency of NDM-1 by changing it to Trp (8). They found that the Tyr229Trp mutant had higher kcat and Km values than those of wild-type NDM-1, thus resulting in 1- to 7-fold increases in kcat/Km values against different antibiotics. They observed that the improved catalytic efficiency was due to increased flexibility of loop 2 upon replacement of Tyr-229 with Trp.

FIG 1
FIG 1

Cartoon representation of NDM-1. The relative positions of active-site residues and Trp-93 are shown as sticks. The zinc ions (Zn1 and Zn2) are represented as balls.

View this table:
TABLE 1

Steady-state enzyme kinetics of wild-type NDM-1 and the Trp93Ala mutanta

We also determined the MICs of E. coli BL21(λDE3) harboring blaNDM-1 or blaTrp93Ala to evaluate the effect of mutation on the resistance pattern (Table 2). E. coli BL21(λDE3) harboring blaNDM-1 showed strong resistance to ampicillin and cefotaxime, with MICs of >256 mg/liter. Mid-range MICs were observed for cefoxitin, ceftazidime, imipenem, and meropenem, i.e., in the range of 8 to 64 mg/liter (Table 2). On mutation of Trp-93 to Ala, the MICs of ampicillin, cefotaxime, cefoxitin, and meropenem were decreased 8-fold, while for ceftazidime and imipenem, we observed a 4-fold reduction in MICs. Our MICs together with kinetics data clearly showed that Trp93Ala mutant had poor ability to hydrolyze β-lactam antibiotics.

View this table:
TABLE 2

MICs of wild-type NDM-1 and the Trp93Ala mutant for various antibiotics

To probe the effect of Trp93Ala mutation on the overall structure and stability of the protein, we measured far-UV circular dichroism (CD) spectra and analyzed thermal denaturation profiles (Fig. 2). The far-UV CD spectrum of NDM-1 was a characteristic spectrum of a typical protein rich in α-helix and β-sheets, with peaks at 218 nm and 222 nm (Fig. 2A). The MREs of wild-type NDM-1 at 218 nm and 222 nm were −13,130 ± 230 degrees · cm2 · dmol−1 and −12,583 ± 310 degrees · cm2 · dmol−1, respectively. The MRE at 222 nm was used to calculate the α-helical content of the protein using equation 4, and it was found that the α-helical content of wild-type NDM-1 was about 33.9% ± 0.4%. Our results are in agreement with the α-helical content (30 to 34%) reported for the crystal structure of wild-type NDM-1 (24–26). On mutating Trp-93 to Ala, we observed a distorted far-UV CD spectrum along with a decreased α-helical content (31.0% ± 0.2%). The MREs of the Trp93Ala mutant at 218 nm and 222 nm were also reduced to −12,596 ± 180 degrees · cm2 · dmol−1 and −11,745 ± 210 degrees · cm2 · dmol−1, respectively. These results clearly indicate that the secondary structure of NDM-1 was slightly disrupted on mutation of Trp-93 to Ala.

FIG 2
FIG 2

Biophysical characterization of NDM-1 and its Trp93Ala mutant. (A) Far-UV CD spectra (A) and thermal denaturation profiles (inset) of NDM-1 and Trp93Ala mutant proteins; (B) fraction denaturation profiles and changes in Gibbs free energy (inset) of NDM-1 and the Trp93Ala mutant as a function of temperature.

Further, we gained insight into the overall stability of NDM-1 and the Trp93Ala mutant by analyzing their thermal denaturation profiles: we found that the thermal stability of NDM-1 was decreased considerably on mutation of Trp-93 to Ala (Fig. 2A, inset). The Tm values were calculated from the fD versus T plot (Fig. 2B) as the temperature at which 50% of the protein molecules were denatured (i.e., when fD was 0.5). The Tm values of wild-type NDM-1 and the Trp93Ala mutant were estimated to be 57.4 ± 0.4°C and 52.6 ± 0.3°C, respectively. Previously, Makena and coworkers studied the thermal stability of NDM-1 and its natural variants and reported that the Tm of NDM-1 was 59.5 ± 0.1°C (16). They found that the double-substitution natural variants (such as NDM-8) were more stable than the single-substitution variants, like NDM-4 and NDM-7. However, a conclusion drawn only on the basis of Tm is not accurate, as the overall stability of a protein also depends on enthalpy and entropy changes accompanying a denaturation process. We therefore calculated changes in enthalpy and entropy and found that at Tm, changes in enthalpy (ΔHm) and entropy (ΔSm) were 143.5 ± 11 kcal/mol and 369.6 ± 3 cal/mol/K for NDM-1 and 121.9 ± 8 kcal/mol and 332.6 ± 4 cal/mol/K for the Trp93Ala mutant (Fig. 2B, inset). The decrease in ΔHm of NDM-1 clearly indicated that the close packing of the protein was decreased as a result of mutation of Trp-93 to Ala. Moreover, we also calculated the change in Gibbs free energy at 25°C (ΔGDo) using a ΔCp value of 4.47 kcal/mol/K (calculated from the relation ΔCp = 172 + 17.6 × number of residues) − 164 × number of disulfide bonds). We found that the ΔGDo of wild-type NDM-1 (−6.7 ± 0.3 kcal/mol) was decreased significantly on changing Trp-93 to Ala (−4.9 ± 0.2 kcal/mol). An explanation for the decrease in the stability of the Trp93Ala mutant can be gained from the structure of NDM-1. We found from the X-ray structure of NDM-1 that Trp-93 forms five hydrogen bonds with Ser-63, Val-73, Gln-97, and Gln-123 and two carbon hydrogen bonds with Ser-63 and Gln-123 (Table 3). Moreover, Trp-93 was also found to interact with Leu-65, Val-73, Gln-123, and Asp-124 through hydrophobic interactions (Table 3). It is clear from Table 3 that the decrease in stability of the Trp93Ala mutant can be attributed to the loss of two hydrogen bonds (Nε1 of Trp-93) with O atoms of Ser-63 and Val-73 and one carbon hydrogen bond (Cδ1 of Trp-93) with an O atom of Ser-63. Moreover, hydrophobic interactions of Trp-93 with Leu-65, Val-73, Gln-123, and Asp-124 were also lost in the Trp93Ala mutant.

View this table:
TABLE 3

Interaction of Trp-93 and Ala-93 with other amino acid residues

We conclude that Trp-93 plays a significant role in maintaining the proper orientation of the active site of NDM-1 and also contributes considerably to the overall stability of the enzyme. Our study together with the work of Chen et al. (8) emphasizes the need to further address the significance of non-active-site residues in the structure, function, and evolution of NDM-1. Such studies will help us to better understand the mechanism by which NDM-1 hydrolyzes β-lactam antibiotics and to develop novel inhibitors directed toward specific amino acid residues. For instance, Trp-93 could be specifically targeted to inhibit metallo-β-lactamases, as it is highly conserved and plays an important role in maintaining the overall structure and stability of the enzyme.

ACKNOWLEDGMENTS

M.T.R. is thankful to the University Grants Commission for a Dr. D. S. Kothari Postdoctoral Fellowship.

We have no conflicts of interest to declare.

FOOTNOTES

    • Received 22 May 2015.
    • Returned for modification 8 August 2015.
    • Accepted 18 October 2015.
    • Accepted manuscript posted online 2 November 2015.

REFERENCES

  1. 1.↵
    1. Khan AU,
    2. Nordmann P
    . 2012. NDM-1-producing Enterobacter cloacae and Klebsiella pneumoniae from diabetic foot ulcers in India. J Med Microbiol 61:454–456. doi:10.1099/jmm.0.039008-0.
    OpenUrlCrossRefPubMed
  2. 2.↵
    1. Yong D,
    2. Toleman MA,
    3. Giske CG,
    4. Cho HS,
    5. Sundman K,
    6. Lee K,
    7. Walsh TR
    . 2009. Characterization of a new metallo-β-lactamase gene, blaNDM-1, and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob Agents Chemother 53:5046–5054. doi:10.1128/AAC.00774-09.
    OpenUrlAbstract/FREE Full Text
  3. 3.↵
    1. Patel G,
    2. Bonomo RA
    . 2013. “Stormy waters ahead”: global emergence of carbapenemases. Front Microbiol 4:48.
    OpenUrlCrossRefPubMed
  4. 4.↵
    1. Ambler RP,
    2. Coulson AF,
    3. Frere JM,
    4. Ghuysen JM,
    5. Joris B,
    6. Forsman M,
    7. Levesque RC,
    8. Tiraby G,
    9. Waley SG
    . 1991. A standard numbering scheme for the class A β-lactamases. Biochem J 276:269–270.
    OpenUrlFREE Full Text
  5. 5.↵
    1. Bush K,
    2. Jacoby GA,
    3. Medeiros AA
    . 1995. A functional classification scheme for beta-lactamases and its correlation with molecular structure. Antimicrob Agents Chemother 39:1211–1233. doi:10.1128/AAC.39.6.1211.
    OpenUrlFREE Full Text
  6. 6.↵
    1. Green VL,
    2. Verma A,
    3. Owens RJ,
    4. Phillips SE,
    5. Carr SB
    . 2011. Structure of New Delhi metallo-β-lactamase 1 (NDM-1). Acta Crystallogr Sect F 67:1160–1164. doi:10.1107/S1744309111029654.
    OpenUrlCrossRefPubMed
  7. 7.↵
    1. Kim Y,
    2. Cunningham MA,
    3. Mire J,
    4. Tesar C,
    5. Sacchettini J,
    6. Joachimiak A
    . 2013. NDM-1, the ultimate promiscuous enzyme: substrate recognition and catalytic mechanism. FASEB J 27:1917–1927. doi:10.1096/fj.12-224014.
    OpenUrlCrossRefPubMedWeb of Science
  8. 8.↵
    1. Chen J,
    2. Chen H,
    3. Shi Y,
    4. Hu F,
    5. Lao X,
    6. Gao X,
    7. Zheng H,
    8. Yao W
    . 2013. Probing the effect of the non-active site mutation Y229W in New Delhi metallo-β-lactamase by site-directed mutagenesis, kinetic studies, and molecular dynamics simulation. PLoS One 8:e82080. doi:10.1371/journal.pone.0082080.
    OpenUrlCrossRefPubMed
  9. 9.↵
    1. Bebrone C,
    2. Delbruck H,
    3. Kupper MB,
    4. Schlomer P,
    5. Willmann C,
    6. Frere JM,
    7. Fischer R,
    8. Galleni M,
    9. Hoffmann KMV
    . 2009. The structure of the di-zinc subclass B2 metallo-β-lactamase CphA reveals that the second inhibitory zinc ion binds in the histidine site. Antimicrob Agents Chemother 53:4464–4471. doi:10.1128/AAC.00288-09.
    OpenUrlAbstract/FREE Full Text
  10. 10.↵
    1. Shakil S,
    2. Khan AU
    . 2010. Infected foot ulcers in male and female diabetic patients: a clinico-bioinformative study. Ann Clin Microbiol Antimicrob 9:2. doi:10.1186/1476-0711-9-2.
    OpenUrlCrossRefPubMed
  11. 11.↵
    1. Shakil S,
    2. Akram M,
    3. Ali SM,
    4. Khan AU
    . 2010. Acquisition of extended-spectrum beta-lactamase producing Escherichia coli strains in male and female infants admitted to a neonatal intensive care unit: molecular epidemiology and analysis of risk factors. J Med Microbiol 59:948–954. doi:10.1099/jmm.0.020214-0.
    OpenUrlCrossRefPubMedWeb of Science
  12. 12.↵
    1. Shen B,
    2. Yu Y,
    3. Chen H,
    4. Cao X,
    5. Lao X,
    6. Fang Y,
    7. Shi Y,
    8. Chen J,
    9. Zheng H
    . 2013. Inhibitor discovery of full-length New Delhi metallo-β-lactamase-1 (NDM-1). PLoS One 8:e62955. doi:10.1371/journal.pone.0062955.
    OpenUrlCrossRefPubMed
  13. 13.↵
    1. Hunt JB,
    2. Neece SH,
    3. Ginsburg A
    . 1985. The use of 4-(2-pyridylazo) resorcinol in studies of zinc release from Escherichia coli aspartate transcarbamoylase. Anal Biochem 146:150–157. doi:10.1016/0003-2697(85)90409-9.
    OpenUrlCrossRefPubMedWeb of Science
  14. 14.↵
    Clinical and Laboratory Standards Institute. 2014. Performance standards for antimicrobial susceptibility testing: 21st informational supplement. M100-S24. CLSI, Wayne, PA.
  15. 15.↵
    1. Andrews JM
    . 2001. Determination of minimum inhibitory concentrations. J Antimicrob Chemother 48(Suppl 1):5–16. doi:10.1093/jac/48.suppl_1.5.
    OpenUrlCrossRefPubMedWeb of Science
  16. 16.↵
    1. Makena A,
    2. Brem J,
    3. Pfeffer I,
    4. Geffen RE,
    5. Wilkins SE,
    6. Tarhonskaya H,
    7. Flashman E,
    8. Phee LM,
    9. Wareham DW,
    10. Schofield CJ
    . 2015. Biochemical characterization of New Delhi metallo-β-lactamase variants reveals differences in protein stability. J Antimicrob Chemother 70:463–469. doi:10.1093/jac/dku403.
    OpenUrlCrossRefPubMed
  17. 17.↵
    1. Chen YH,
    2. Yang JT,
    3. Martinez HM
    . 1972. Determination of the secondary structures of proteins by circular dichroism and optical rotatory dispersion. Biochemistry 11:4120–4131. doi:10.1021/bi00772a015.
    OpenUrlCrossRefPubMed
  18. 18.↵
    1. Kather I,
    2. Jakob RP,
    3. Dobbek H,
    4. Schmid FX
    . 2008. Increased folding stability of TEM-1 β-lactamase by in vitro selection. J Mol Biol 383:238–251. doi:10.1016/j.jmb.2008.07.082.
    OpenUrlCrossRefPubMedWeb of Science
  19. 19.↵
    1. Robertson AD,
    2. Murphy KP
    . 1997. Protein structure and the energetics of protein stability. Chem Rev 97:1251–1267. doi:10.1021/cr960383c.
    OpenUrlCrossRefPubMedWeb of Science
  20. 20.↵
    1. Yadav S,
    2. Ahmad F
    . 2000. A new method for the determination of stability parameters of proteins from their heat-induced denaturation curves. Anal Biochem 283:207–213. doi:10.1006/abio.2000.4641.
    OpenUrlCrossRefPubMed
  21. 21.↵
    1. Zhu K,
    2. Lu J,
    3. Liang Z,
    4. Kong X,
    5. Ye F,
    6. Jin L,
    7. Geng H,
    8. Chen Y,
    9. Zheng M,
    10. Jiang H,
    11. Li JQ,
    12. Luo C
    . 2013. A quantum mechanics/molecular mechanics study on the hydrolysis mechanism of New Delhi metallo-β-lactamase-1. J Comput Aid Mol Des 27:247–256. doi:10.1007/s10822-012-9630-6.
    OpenUrlCrossRef
  22. 22.↵
    1. Nordmann P,
    2. Baulanger AE,
    3. Poirel L
    . 2012. NDM-4 metallo-β-lactamase with increased carbapenemase activity from Escherichia coli. Antimicrob Agents Chemother 56:2184–2186. doi:10.1128/AAC.05961-11.
    OpenUrlAbstract/FREE Full Text
  23. 23.↵
    1. Hornsey M,
    2. Phee L,
    3. Warcham DW
    . 2011. A novel variant, NDM-5, of the New Delhi metallo-β-lactamase in a multidrug-resistant Escherichia coli ST648 isolate recovered from a patient in the United Kingdom. Antimicrob Agents Chemother 55:5952–5954. doi:10.1128/AAC.05108-11.
    OpenUrlAbstract/FREE Full Text
  24. 24.↵
    1. Zhang HM,
    2. Hao Q
    . 2011. Crystal structure of NDM-1 reveals a common β-lactam hydrolysis mechanism. FASEB J 25:2574–2582. doi:10.1096/fj.11-184036.
    OpenUrlCrossRefPubMed
  25. 25.↵
    1. King DT,
    2. Worrall LJ,
    3. Gruninger R,
    4. Strynadka NCJ
    . 2012. New Delhi metallo-β-lactamase: structural insights into β-lactam recognition and inhibition. J Am Chem Soc 134:11362–11365. doi:10.1021/ja303579d.
    OpenUrlCrossRefPubMed
  26. 26.↵
    1. Feng H,
    2. Ding J,
    3. Zhu D,
    4. Liu X,
    5. Xu X,
    6. Zhang Y,
    7. Zang S,
    8. Wang DC,
    9. Liu W
    . 2014. Structural and mechanistic insights into NDM-1 catalyzed hydrolysis of cephalosporins. J Am Chem Soc 136:14694–14697. doi:10.1021/ja508388e.
    OpenUrlCrossRefPubMed
View Abstract
Back to top
Download PDF
Citation Tools
Print

Alerts
Email

Related Articles

Cited By...