Article Figures & Data
Figures
- FIG 1
MICs for TGC in fluoroquinolone-susceptible and -resistant E. coli clinical isolates. Susceptible and resistant, as defined by EUCAST, are indicated by dashed lines. S, susceptible; I, intermediate; R, resistant; FQSECs, fluoroquinolone-susceptible E. coli isolates; EQRECs, fluoroquinolone-resistant E. coli clinical isolates.
- FIG 2
Expression levels of mRNA for acrA (A) and acrB (B), and intracellular TGC concentrations (C) in E. coli clinical isolates. (A and B) Expression of acrA (A) and acrB (B) mRNAs. Values on the y axis are shown as relative expression normalized against a reference strain, ATCC 25922 as 1. (C) Intracellular TGC concentrations. Values on the x axis represent the MIC for TGC (mg/liter). Left panels, results for individual strains. White bars represent fluoroquinolone-susceptible E. coli isolates (CIP MIC, <0.125 mg/liter), and black bars represent fluoroquinolone-resistant E. coli isolates (CIP MIC, >2 mg/liter). Dashed lines show the level for the reference strain, ATCC 25922. *, P < 0.05; **, P < 0.01 (compared with ATCC 25922). Error bars represent the standard deviation. Right panels, relationship between the measurements and the MIC for TGC (mg/liter). Empty diamond, value for the reference strain, ATCC 25922.
- FIG 3
Expression levels of acrA and acrB mRNAs in mutants derived from strains SE179 (A) and SME212 (B) with reduced TGC susceptibility caused by exposure to CIP. The expression of acrA and acrB mRNA in mutants derived from SME179 and SME212 after continuous stepwise CIP exposure in LB broth is shown. Values on the y axis are shown as relative expression normalized against a reference strain, ATCC 25922 as 1. The CIP and TGC MICs and genetic analyses for these mutants are shown in Table 4.
Tables
- TABLE 1
Characteristics and antibiogram of TGC-resistant/nonsusceptible E. coli clinical isolates
Strain Specimen Patient age (yr) Patient gender Yr Phylogenetic group Serotype Sequence type MIC (mg/liter)a β-Lactamase(s) CAZ (>16)b CPD (>1) FEP (>4) IPM (>8) GEN (>4) AMK (>16) CIP (>1) TGC (>2) FOF (>32) HUE1 Urine catheter 77 Female 2008 A O125:H37 48 <4 (S)b 4 (R) 0.5 (S) 0.125 (S) 64 (R) 0.5 (S) 4 (R) 16 (R) 0.5 (S) NTc SRE54 Urine 78 Female 2008 B2 O25b:H4 131-H30R 4 (S) >128 (R) 8 (R) 0.125 (S) 64 (R) 2 (S) 256 (R) 4 (R) 64 (R) TEM-1b, CTX-M-14 SME37 Vaginal fluids 39 Female 2008 B2 O25b:H4 131-H30R 16 (I) >128 (R) 4 (I) 0.06 (S) 0.5 (S) 1 (S) 128 (R) 2 (I) 0.5 (S) CTX-M14 SRE58 Scrotum 60 Male 2008 B2 O25b:H4 131-H30R 64 (R) >128 (R) 128 (R) 0.25 (S) 1 (S) 4 (S) 256 (R) 2 (I) 0.5 (S) TEM-1b, CTX-M-2, CMY-8 SME108 Urine 41 Male 2015 D O1 648 1 (S) 0.5 (S) 0.125 (S) 0.06 (S) 64 (R) 1 (S) 128 (R) 2 (I) 0.5 (S) NT SRE82 Feces 69 Female 2015 B2 O25b:H4 131-H30R 8 (S) 32 (R) 0.125 (S) 0.125 (S) 1 (S) 1 (S) 128 (R) 2 (I) 1 (S) NT SRE48 Urine 48 Male 2015 B2 O25b:H4 131-H30R 16 (I) >128 (R) 4 (I) 0.125 (S) 0.5 (S) 1 (S) 128 (R) 2 (I) 1 (S) CTX-M-27 - TABLE 2
Mutations in genes associated with CIP or TGC resistance in TGC-resistant/intermediate E. coli clinical isolatesa
Strain QRDR mutations PMQR Mutation(s) marA expression (mean ± SD)b MIC (mg/liter) AcrR MarR CIP TGC HUE1 WT qnrS c Disrupted c (219_220InsIS3-IS629) Disrupted c (ΔC at 223) 142.2 ± 9.0 4c 16 SRE54 GyrA S83L, D87N; ParC S80I, E84V NDf Disrupted (273_274insIS1) L71P (CTG→CCG) d, G103S, Y137H 506.7 ± 52.2 256 4 SME37 GyrA S83L, D87N; ParC S80I, E84V ND Disrupted (570_571insIS1) Disrupted (110_111insTATTTCCGCTGGA) 57.5 ± 3.2 128 2 SRE58 GyrA S83L, D87N; ParC S80I, E84V ND Disrupted (273_274insIS1) K44Y(AAG→TAC) d, G103S, Y137H 50.8 ± 3.4 256 2 SME108 GyrA S83L, D87N; ParC S80I, E84G ND H115Y e (CAC→TAC) A53E (GCG→GAG)d, G103S, Y137H 0.4 ± 0.1 128 2 SRE82 GyrA S83L, D87N; ParC; S80I, E84V ND Disrupted (Δ126_135) G103S, Y137H 2.0 ± 0.6 64 2 SRE48 GyrA S83L, D87N, ParC S80I, E84V ND R13S (CGC→AGC) d M1G (GTG→GGG) d, G103S, Y137H 20.8 ± 3.9 128 2 ↵a Abbreviations: QRDR, quinolone resistance-determining region; PMQR, plasmid-mediated quinolone resistance gene; CIP, ciprofloxacin; TGC, tigecycline. Boldface indicates a contribution to the overexpression of acrAB.
↵b marA expression is shown as relative expression level normalized against reference strain ATCC 25922 as 1.
↵c Data were reported previously (31).
↵d Novel mutation found in this study.
↵e Mutation associated with overexpression of acrA or acrB in E. coli previously reported (28).
↵f ND, not detected.
- TABLE 3
TGC and CIP susceptibilities of mutants with defective efflux pump genes derived from TGC-resistant/intermediate E. coli clinical isolates
Strain MIC (mg/liter) CIP TGC SRE54 256 4 SRE54 ΔacrAB 4 0.25 SRE54-ΔacrAB/pHSG576 4 0.25 SRE54 ΔacrAB/pHSGacrAB 256 4 SME37 128 2 SME37 ΔacrAB 8 0.25 SME37 ΔacrAB/pHSG576 8 0.25 SME37Δ acrAB/pHSGacrAB 128 2 SRE58 256 2 SRE58 ΔacrAB 16 0.25 SRE58 ΔacrAB/pHSG576 16 0.25 SRE58 ΔacrAB/pHSGacrAB 256 2 SME108 128 2 SME108 ΔacrAB 8 0.25 SME108 ΔacrAB/pHSG576 8 0.25 SME108 ΔacrAB/pHSGacrAB 128 2 SRE82 128 2 SRE82 ΔacrAB 8 0.25 SRE82 ΔacrAB/pHSG576 8 0.25 SRE82 ΔacrAB/pHSGacrAB 128 2 SRE48 128 2 SRE48 ΔacrAB 8 0.25 SRE48 ΔacrAB/pHSG576 8 0.25 SRE48 ΔacrAB/pHSGacrAB 128 2 HUE1 4 16 HUE1 ΔacrAB 1 0.25 HUE1 ΔacrAB/pMW219 1 0.25 HUE1 ΔacrAB/pMWacrAB 4 8 HUE1 ΔacrF 2 2 - TABLE 4
CIP and TGC MICs and mutations in acrR, marR, and QRDR of mutants with reduced susceptibility to TGC and CIP selected by in vitro CIP exposurea
Strain CIP concn in LB broth (mg/liter) MIC (mg/liter) Mutationsb CIP TGC AcrR MarR QRDRa mutations ATCC 25922 0 0.015 0.25 WT WT WT ATCC 25922CIP0.008 0.008 0.015 0.25 NT NT NT ATCC 25922CIP0.01 0.015 0.015 0.25 WT WT WT ATCC 25922CIP0.03 0.03 0.125 1 T5N c (ACC→AAC) Disrupted (ΔG at 311) WT SME21 0 0.008 0.25 WT WT WT SME21CIP0.008 0.008 0.008 0.25 NT NT NT SME21CIP0.01 0.01 0.01 0.5 NT NT NT SME21CIP0.03 0.03 0.03 0.5 WT Disrupted (Q117stop, CAG→TAG) WT SME21CIP0.06 0.125 0.125 1 Disrupted (339_340ins) d Disrupted (Q117stop, CAG→TAG) WT SME207 0 0.01 0.25 WT V79I, G103S, Y137H WT SME207CIP0.01 0.008 0.01 0.25 NT NT NT SME207CIP0.03 0.01 0.03 0.25 NT NT NT SME207CIP0.06 0.03 0.03 0.25 NT NT NT SME207CIP0.125 0.06 0.06 0.25 NT NT NT SME207CIP0.25 0.125 0.25 0.25 NT NT NT SME207CIP0.5 0.25 0.5 0.25 NT NT NT SME207CIP1 0.5 0.5 0.5 I62L c (ATC→CTC) A70T c (GCA→ACA), V79I, G103S, Y137H GyrA ΔS83 (Δ247_249) SME183e 0 1 0.5 WT G103S, Y137H WT SME183CIP0.5 0.5 1 0.5 NT NT NT SME183CIP1 1 2 1 Disrupted (488_489insTCGGC) G103S, Y137H WT SME19 0 0.01 0.25 WT S3N, G103S, Y137H WT SME19CIP0.01 0.01 0.01 0.25 NT NT NT SME19CIP0.03 0.03 0.03 0.25 NT NT NT SME19CIP0.06 0.06 0.06 0.25 NT NT NT SME19CIP0.125 0.125 0.5 0.25 NT NT NT SME19CIP1 1 1 0.25 NT NT NT SME19CIP2 2 4 0.25 NT NT NT SME19CIP4 4 4 0.25 WT S3N, G103S, Y137H GyrA S83L-D87Y SME65 0 0.06 1 WT G69E (GGG→GAG) c, G103S WT SME65CIP0.03 0.03 1 1 NT NT NT SME65CIP0.06 0.06 1 1 NT NT NT SME65CIP0.125 0.125 1 1 NT NT NT SME65CIP0.25 0.25 1 1 NT NT NT SME65CIP0.5 0.5 1 1 NT NT NT SME65CIP1 1 1 1 WT G69E (GGG→GAG) c, G103S GyrA S83L SME179e 0 0.25 0.5 WT G103S, Y137H WT SME179CIP0.125 0.125 0.25 0.5 NT NT NT SME179CIP0.25 0.25 0.25 0.5 NT NT NT SME179CIP0.5 0.5 1 1 WT R86W (AGG→TGG) c, G103S, Y137H WT SME179CIP1 1 2 4 T5N c (ACC→AAC) R86W (AGG→TGG) c, G103S, Y137H WT SME212 0 0.03 0.5 WT G103S WT SME212CIP0.01 0.01 0.03 0.5 NT NT NT SME212CIP0.03 0.03 0.06 1 NT NT NT SME212CIP0.06 0.06 0.125 1 WT G103S GyrA S83P SME212CIP0.125 0.125 0.125 1 NT NT NT SME212CIP0.25 0.25 1 1 NT NT NT SME212CIP0.5 0.5 2 1 NT NT NT SME212CIP1 1 2 1 WT G103S GyrA S83P-D87G SME212CIP2 2 4 4 WT Disrupted (Δ211_214) GyrA S83P-D87G ↵a QRDR, quinolone resistance-determining region; NT, not tested.
↵b Boldface indicates a contribution to the overexpression of acrAB.
↵c Mutation associated with overexpression of acrA or acrB previously reported (32–34). The S3N, V79I, G103S, and Y137H mutations in MarR do not contribute to overexpression of acrA or acrB (29, 30 33).
↵d Insertion of transposase and part of a mobile element protein gene (nucleotide positions 154 to 504) found in Citrobacter freundii strain P10159 (accession number CP012554.1 ).
↵e Positive for qnrS.
- TABLE 5
Primer sequences used for RT-PCR
Target gene Forward primer (5′–3′) Reverse primer (5′–3′) Product size (bp) acrA CTCTCAGGCAGCTTAGCCCTAA TGCAGAGGTTCAGTTTTGACTGTT 107 acrB GGTCGATTCCGTTCTCCGTTA CTACCTGGAAGTAAACGTCATTGGT 105 marA AATCGCGCAAAAGCTGAAGG ATGCGGCGGAACATCAAAGT 121 rrsE GTACACACCGCCCGTCACAC GTGATCCAACCGCAGGTTCC 144 gyrB CGATATTCGCCGCTTTCAGG CGTCGTATGCTGCGCGTTAC 130
