Article Figures & Data
Figures
- FIG 1
Agarose gel (1.5% agarose) electrophoresis at 40 V for 3 h showing the detection of R. oryzae CYP51 transcripts using genomic DNA (lanes 1 and 3) and cDNA (lanes 2 and 4) as the templates. Lanes 1 and 2, amplification of RoCYP51A (RO3G_16595) 1,626-nt and 1,524-nt bands, respectively; lanes 3 and 4, the resolved PCR bands of RoCYP51B (RO3G_11790) at 1,755 nt and 1,533 nt, respectively.
- FIG 2
Neighbor-joining phylogenetic tree of 55 different fungal 14-α sterol demethylases, including enzymes from 9 Ascomycetes yeast species, 20 Ascomycetes mold species, 9 Basidiomycetes species, and 7 Mucorales species. GenBank accession numbers appear after the species names. Some fungal genus names were abbreviated as follows to esthetically improve the figure: A., Aspergillus; S., Saccharomyces; C., Candida; F., Fusarium; R., Rhizopus.
- FIG 3
(A, B) Selection plates using FLC (100 μg/ml) where LMDM-1229 (A) and LMDM-1230 (B) transformants were obtained. (C, D) Replica plates used minimal medium (C) and minimal medium with 450 μg/ml hygromycin B (D).
- FIG 4
(A) Scheme of the LMDM-p134 vector generation process used in this work. Striped and black boxes represent the 5′ and 3′ UTRs of the AfCYP51A included and not included in the transformation vector, respectively. Light gray boxes denote the RoCYP51A (RO3G_16595) complete coding sequence obtained from cDNA. Dark gray boxes show the C- and N-terminal fractions of AfCYP51A (12, 32). Thin lines in LMDM-p125 and LMDM-p134 symbolize the pGEM-T Easy vector. Arrows represent primers, and their coloring shows where they hybridized to each of the genomic or vector DNAs. (B) Integration and homologous recombination confirmation by using PCRs. Lane M, 100-nt ladder (numbers on the left are in nucleotides); lanes 1 to 4, RoCYP51A (RO3G_16595) exon 3 amplifications using the P-RoCYP51F3 and P-RoCYP51R3 primers (1,374 nt); lanes 5 to 8, multiplex PCR with the A13, A5R and P-RoCYP51R1 primers to confirm homologous recombination (by the presence of the 1,286-nt band) or the lack of existence of RoCYP51A (RO3G_16595) in the A. fumigatus genome (by the presence of the 1,461-nt band); lane 1, LMDM-p134; lanes 2 and 5, R. oryzae ATCC 11886; lanes 3 and 6, A. fumigatus LMDM-1229; lane 7, A. fumigatus LMDM-1230; lanes 4 and 8, A. fumigatus LMDM-32.
- FIG 5
Disk diffusion susceptibility testing using fluconazole (FLC) and voriconazole (VRC) paper disks for LMDM-31 (parental strain akuBKU80Δ) (31), LMDM-32 (recipient strain akuBKU80Δ CYP51AΔ) (12), R. oryzae ATCC 11886, and A. fumigatus chimera LMDM-1229 (akuBKU80Δ RoCYP51A).
Tables
- TABLE 1
Antifungal susceptibility testing results for the strains used in this study
Strain MIC or MEC value (μg/ml)a FLC PSC ITC VRC AMB CSF ANF LMDM-31 >320.00 (0) 0.25 0.12 0.12 (32) 0.50 0.06 0.03 LMDM-32 16.00 (19) 0.12 0.03 0.03 (48) 0.50 0.06 0.03 ATCC 11886 >320.00 (0) 1.00 1.00 >8.00 (0) 2.00 >8.00 >8.00 LMDM-1229 >320.00 (0) 1.00 1.00 >8.00 (0) 0.50 0.06 0.03 LMDM-1230 >320.00 (0) 1.00 1.00 >8.00 (0) 0.50 0.06 0.03 ↵a MIC values were obtained on three different days by using the protocol published by CLSI (document M38-A2) (17) and are presented as geometric means. Inhibition diameters (in millimeters) for fluconazole and voriconazole are displayed in parentheses and were obtained by the agar diffusion method following the procedures described in CLSI document M51-A (37). The values are presented as the arithmetic means for three repetitions. FLC, fluconazole; PSC, posaconazole; ITC, itraconazole; VRC, voriconazole; AMB, amphotericin B; CSF, caspofungin; ANF, anidulafungin. MEC values were obtained for CSF and ANF.
- TABLE 2
Primers used in this work
Primer Target organism(s) Sequence (5′-3′)a Orientation Use R-RoCYP51F1 A. fumigatus GAATATATACGTCGATCTGTGTG Sense LMDM-p134 construction R-RoCYP51R1 A. fumigatus GTAAGGTGGATATGATGGCCATTTCGAGGAGACACAGGGAGG Antisense LMDM-p134 construction R-RoCYP51F2 A. fumigatus/R. oryzae CCCTCCCTGTGTCTCCTCGAAATGGCCATCATATCCACCTTAC Sense LMDM-p134 construction R-RoCYP51R2 A. fumigatus/R. oryzae GTCCTCGATGGTTACAACAGTCTTATTGCTTTCTAGCTCTATAACG Antisense LMDM-p134 construction R-RoCYP51F3 A. fumigatus CGTTATAGAGCTAGAAAGCAATAAGACTGTTGTAACCATCGAGGAC Sense LMDM-p134 construction R-RoCYP51R3 A. fumigatus ATCCCAGCAGATACGCTGGTC Antisense LMDM-p134 construction P-RoCYP51F1 R. oryzae CCCCATATGGCCATCATATCCACCTTACTT Sense R. oryzae CYP51A amplification P-RoCYP51R3 R. oryzae GGGGTCGACTTAAAGCTTTTGCTTTCTAGCTCTATAACGA Antisense R. oryzae CYP51A amplification, evaluation of LMDM-p134 integration P-RoCYP51FB R. oryzae CCCCATATGGCTGTCATCTCCACTTTACTCC Sense R. oryzae CYP51B amplification P-RoCYP51RB R. oryzae GGGGTCGACCTAAAGCTTTTCTCTCCAAGTGTATTTGATG Antisense R. oryzae CYP51B amplification P-RoCYP51F3 R. oryzae CGATCGAATTTGGAAAAAACCCCATCGAATTCCTTCA Sense Evaluation of LMDM-p134 integration A13 A. fumigatus CTTCCCACATCCATCTTCT Sense Evaluation of LMDM-p134 homologous recombination A5R A. fumigatus TCTCTGCACGCAAAGAAG Antisense Evaluation of LMDM-p134 homologous recombination P-RoCYP51R1 R. oryzae GGATCTTTGGGTTGAATAAACTGAGATAAAAGATGAATGAC Antisense Evaluation of LMDM-p134 homologous recombination ↵a Letters in bold indicate the start and stop codon of R. oryzae CYP51s.
