Table 1.

Primers used for PCR

PrimerGeneFragmentaSize (bp)Nucleotide sequence (5′–3′)Position in sequenceb
cml01floR494TTTGGWCCGCTMTCRGAC4649–4666
cml15floRSGAGAARAAGACGAAGAAG5143–5125
int1int1A1,135GCTCTCGGGTAACATCAAGG1267–1286
aadaadA2GACCTACCAAGGCAACGCTA2402–2383
sulTERsulIdelta1B942AAGGATTTCCTGACCCTG3567–3584
F3floRAAAGGAGCCATCAGCAGCAG4509–4490
F4floRC598TTCCTCACCTTCATCCTACC5360–5379
F6tetRTTGGAACAGACGGCATGG5958–5940
tetRtetRD1,559GCCGTCCCGATAAGAGAGCA6205–6224
tetAtetAGAAGTTGCGAATGGTCTGCG7764–7745
int2groEL-Int1E1,338TTCTGGTCTTCGTTGATGCC10764–10783
pse1blaPSE-1CATCATTTCGCTCTGCCATT12102–12083