TABLE 5

Primer sequences

GeneaForward primer (5′-3′)Reverse primer (5′-3′)
alpAGGTAGGCTCTGGGACTTGTGTGGTGTTCGTGCCGTAGTTA
alpBACGAAATGGTTGGCTCTATCACGCTTGGTTATTGGCGTTTA
babAGGTGGGGTTTTGGAATGTCTTAAAAGAACAGGTGATGGAAGTGGA
flaATTCTATCGGCTCTACCACTTCATCACGCCATCCACTTGTTTA
flaBCGCGCACGCAATTAGACATCGCACTCTCTTCAGCAAAATC
16S geneCGATGGATGCTAGTTGTTGGAGGTCCCCGTCTATTCCTTTGAGTT
TNF-α geneGCACCACCATCAAGGACTCATCGAGGCTCCAGTGAATTCG
IL-1β geneACACTCCTTAGTCCTCGGCCATGGTTTCTTGTGACCCTGAGC
COX-2 geneCAGGAAGTCTTTGGTCTGGTGCCGCTGGTTTGGAATAGTTGCTCATCA
iNOS geneGGCAGCCTGTGAGACCTTTGCGTTTCGGGATCTGAATGTGA
GAPDH geneAGGTTGTCTCCTGCGACTTCACCAGGAAATGAGCTTGACAAAG
  • a alpA, adherence-associated lipoprotein A gene; alpB, adherence-associated lipoprotein B gene; babA, blood group antigen-binding adhesion gene; flaA, flagellin A gene; flaB, flagellin B gene; TNF-α, tumor necrosis factor alpha; IL-1β, interleukin 1β; COX-2, cyclooxygenase-2; iNOS, inducible nitric oxide synthase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.