Table 2.

Primers used in this study

GeneProteinGenBank accession no.PrimerLocationaSequence (5′ to 3′)b
ERG9Squalene synthaseD89610Forward448 to 467AAAATGGGTAATGGTATGGC
Reverse895 to 914ACTTGGGGAATGGCACAAAA
ERG1Squalene epoxidaseU69674Forward583 to 605TTGACAWTTAKTTGTGATGGTAT
Reverse1243 to 1265CTTTGGAAATATTTGAAACAACC
ERG7Squalene cyclaseL04305Forward1584 to 1603TATCCATACGTGGAATGTAC
Reverse2133 to 2154TGTATAWACCTAATGCCTTAAT
ERG11Lanosterol 14α-demethylaseX13296Forward903 to 931ATTGGTATTCTTATGGGTGGTCAACATAC
Reverse1390 to 1416CCCAATACATCTATGTCTACCACCACC
ERG25C-4 Methyl sterol oxidaseAF051914Forward235 to 257ATTCCWTATTTTAGAAAATGGAA
Reverse805 to 825GWAATCCCACCATCTAAAAGA
ERG3Δ5,6-DesaturaseAF069752Forward459 to 482CCWMTTTGAAAAACCAAATG
Reverse961 to 984GAATTGACCGTAGTTGTAGTTGAA
ACT1ActinX16377Forward975 to 1001ACCGAAGCTCCAATGAATCCAAAATCC
Reverse1465 to 1491GTTTGGTCAATACCAGCAGCTTCCAAA
CgACT1C. glabrataactinAF069746Forward45 to 64ATGTGTAAGGCKGGKTTTGC
Reverse1050 to 1069ATCCACATTTGTTGGAAKGT
CDRABC transporters CDR1 andCDR2X77589 and U63812Forward901 to 924GTGGTGTTTCCGGTGGTGAAAGAAA
Reverse1379 to 1403CCTGGTGTTGGATCGTTCACATTCA
CDR1ABC transporter CDR1 specificX77589Forward−184 to −163TTTTTTTTTTTAGTTCATCATC
Reverse242 to 262GGTCATTATTTATTTCTTCAT
CDR2ABC transporter CDR2 specificU63812Forward−187 to −167CTCTATTATGAATACTAGTAG
Reverse239 to 258TTGTTCATGACTATTGTTGC
MDR1Major facilitator superfamily transporterX53823Forward451 to 476GAGTCGTAGCTACATTGCCATTAACA
Reverse1014 to 1040GGTGATTTCTAATGGTCTCCATAATGT
  • a Location refers to the nucleotide sequence within the C. albicans gene (exceptCgACT1), with the “A” of the start codon (ATG) representing +1.

  • b Code for mixed bases within the primer sequence: W = A + T, K = G + T, and M = A + C.