TABLE 1.

Sequences of primers designed for this study

PrimerSequence (5′→3′)aLocation
KPC-1ACGTTCTTGTCTCTCATGGCCblaKPC-1
KPC-1BCCTCGCTGTGCTTGTCATCCblaKPC-1, reverse primer
OXA-48ATTGGTGGCATCGATTATCGGblaOXA-48
OXA-48BGAGCACTTCTTTTGTGATGGCblaOXA-48, reverse primer
OXA-TKext1AATACACGCATAACGTCCCCblaOXA-48, 5′ reverse primer
OXA-1ATCAACTTTCAAGATCGCAblaOXA-47
OXA-1BGTGTGTTTAGAATGGTGAblaOXA-47, reverse primer
OXA-9ATTCGTTTCCGCCACTCTCCCblaOXA-9
OXA-9BACGAGAATATCCTCTCGTGCblaOXA-9, reverse primer
SWSHV-AAAGATCCACTATCGCCAGCAGblaSHV
SWSHV-BATTCAGTTCCGTTTCCCAGCGGblaSHV, reverse primer
TEMalphaGAGTATTCAACATTTCCGTGTCblaTEM
TEMbetaTAATCAGTGAGGCACCTATCTCblaTEM reverse primer
IS1999ACAGCAATTCTTTCTCCGTGIS1999 tnpA
IS1999BCAAGCACAACATCAAGCGCIS1999 tnpA, reverse primer
AAGAGTTTGATCHTGGYTYAGA16S RNA gene
BACGGYTACCTTGTTACGACTTC16S RNA gene
5′CSGGCATCCAAGCAGCAAGattI recombination site
3′CSAAGCAGACTTGACCTGAqacEΔ1, 5′ end, reverse primer
  • a H stands for A, C, or T; Y stands for C or T.