TABLE 1.

Primers used in this study for PCR amplification and sequencing

β-Lactamase geneSequence (5′-3′)aLocation of 5′ end relative to blaGenBank accession no.
ACT-1CCTTGAACTGCTATTACGGA26 bp upstreamU58495
CGCCACCCGGCAATGTTTAC19 bp downstreamU58495
FOX-5ATGCCAATTTCATTCACCAC32 bp upstreamX77455
ATKTGGAMGCCTTGAACTCG25 bp downstreamX77455
CMY-2CGGACACCTTTTTGCTTTTAATTAC37 bp upstreamX91840
GAAAGAAAGGAGGCCCAATA39 bp downstreamX91840
DHA-1GTCCGGTGAATCTGACGATA57 bp upstreamAJ237702
TTAAATTACGGCCCCGGCGT43 bp downstreamAJ237702
  • a K represents G or T, and M stands for A or C.