TABLE 1.

Sequences of oligonucleotide primers used in this study

PrimerGene (orientation)Nucleotide positions in the erm(B) gene regionSequence (5′-3′)
ermBCTF erm(B) (forward)1742-1763GAAATTGGAACAGGTAAAGG
ermBCTR erm(B) (reverse)2126-2145TTTACTTTTGGTTTAGGATG
ermB6 orfζ (reverse)3568-3589CTGACCCTGGTTGCCCACCAAG
tetW43 orfY (forward)1059-1080, 3862-3883aTATCGTATTAGCGGATTAGAGG
tetW47 orfY (reverse)4228-4249TCATCTCTTTAGGCGGTTCTGC
  • a Due to the partial duplication of orfY in OX-7, this primer binds at two sites in the erm(B) gene region.