TABLE 1.

Oligonucleotides used for the amplification of fragments of ribosomal protein, MOMP, and 23S rRNA genes

Primer targetPrimer and sequencePosition
L4 proteinl4-f, 5′ gaagtttgaattgcctgatgc 3′45-65a
l4-r, 5′ ggcttaggaccgaaaacaatc 3′278-258a
L22 proteinl22-f, 5′ agctgcaggattgatgagaaa 3′54-74a
l22-r, 5′ gttagatgactcgtgcgcttc 3′308-288a
23S rRNArr-f, 5′ aagttccgacctgcacgaatgg 3′1952-1973b
rr-r, 5′ tccattccggtcctctcgtac 3′2675-2656b
rrg-f, 5′ aattccttgtcgggtaagttc 3′1937-1957b
al1-r, 5′ cgttatgatcccaggatccct 3′5927-5907c
al2-r, 5′ cccaatatagaaccgaaaattcga 3′5451-5428d
MOMPSe-f, 5′ ccaatatgctcaatctaacc 3′1932-1951a
Se-r, 5′ aattgcaaggagacgatttg 3′2656-2647a
  • a Base positions relative to ATG.

  • b E. coli numbering.

  • c Position in the sequence at GenBank accession no. AE001345.

  • d Position in the sequence at GenBank accession no. AE001347.