TABLE 2.

Locations of features in SCC composite island documented in TPA BK001539

Featurent location in:Characteristic or DNA sequence (5′-3′) complement
BK 001539AE 016744
SCC elements
    SCC composite island1-5747432492-89965
    SCCpbp4 element1-1901532492-51506
    L-C homologous region9950-1901542441-51506Similar to L-C regions of SCCmec type IV
    ccrAB4 homologous region24565-2990457056-62395Similar to nt 6986-12345 of strain HDE288 (accession no. AF411935)
    CadR homologous region38639-4110773585-7605378% similarity to CadR region in SCCmec type III
    MerR homologous region57475-6675480621-8990092% similarity to MerR region in SCCmec type III
SCC repeat sequences
    DRSCC composite island-R (III)1-2932492-32520AAAAACCGCATCATTTATGATATGCTTCG
    DRSCCpbp4-R1-1532492-32506TTATGATATGCTTCG
    DRSCC composite island (II)19016-1904451507-51535AAAAACCGCATCACTTATGATATGCTTCT
    IRSCCpbp4-L18990-1901551481-51506GCTTATCAGTTGATGATGCGGTTTTT
    DRSCCpbp4-L19016-1903051507-51521TTATGATATGCTTCT
    SCC composite island-SCCpbp4 junction inverted repeat18990-1904451481-51535AAAAACCGCATCACTTATGATATGCTTCTGCTTATCAGTTGATGATGCGGTTTTT
    DRSCC-L (1 bp mm)57448-5746089939-89951TTATGATATGCTTCA
    IRSCC-L57450-5747489941-89965AAAAACCGCATCATTTATGATATGC
    DRSCC composite island-L (I)57446-5747489937-89965AAAAACCGCATCATTTATGATATGCTTCA
IS431 elements
    IS431-337850-3863870341-71129
    IS431-248131-4891980622-81410
    IS431-156620-5740989111-89900