TABLE 1.

Sequences of RT-PCR primer-probe sets

GeneProbe and primersSequence
ACT1 ProbeTTGACCTTGAGATACCCAATTGAACACGGTA
Forward primerTTGGTGATGAAGCCCAATCC
Reverse primerCATATCGTCCCAGTTGGAAACA
PMA1 ProbeAGATGTCCACGAAAACTACCAAAACACCGTT
Forward primerTTGAAGATGACCACCCAATCC
Reverse primerGAAACCTCTGGAAGCAAATTCG
ERG11 ProbeTGCCTGACCCTGATTATAGTTCAATGGTGG
Forward primerAACTACTTTTGTTTATAATTTAAGATGGACTATTGA
Reverse primerAATGATTTCTGCTGGTTCAGTAGGT
MDR1 ProbeTCGCAAGGCTAAAAGATTGAGAGCCATCA
Forward primerTTACCTGAAACTTTTGGCAAAACA
Reverse primerACTTGTGATTCTGTCGTTACCG
CDR1 ProbeTAACCCATATGTCAGAAGTGCCCGGG
Forward primerTTTAGCCAGAACTTTCACTCATGATT
Reverse primerTATTTATTTCTTCATGTTCATATGGATTGA
CDR2 ProbeTCCCGGGTTTTGGATTTTCATGTACAGA
Forward primerGGTATTGGCTGGTCCTAATGTGA
Reverse primerGCTTGAATCAAATAAGTGAATGGATTAC