TABLE 1.

Primers used for amplification of the test promoters

GeneOrientationaPrimerb
dinBF (Not)AAAAGCGGCCGCTAGTTTACCCCGCTAAACTTTA
R (Nhe)AAAAGCTAGCATTCCCCCTTTCGTGTGTATAG
yneAF (Not)AAAAGCGGCCGCTCAAAACGTCGATTTTAAGAAG
R (Nhe)AAAAGCTAGCAACCTCCAACAGGAATGTTTGT
yorBF (Not)AAAAGCGGCCGCTTAGAGGAAATGAAATTATGTT
R (Nhe)AAAAGCTAGCATCCCCTGTTTTGAAATTTTTG
fabHBF (Not)AAAAGCGGCCGCTCATAGATTCCTATCTACACTT
R (Nhe)AAAAGCTAGCCACTCCTTATGGTCAGATTATA
glpDF (Not)AAAAGCGGCCGCAGTAATACTATGGTATAATGGT
R (Nhe)AAAAGCTAGCTCCTCCTTGTTGTCACGGTAAA
ytrAF (Not)AAAAGCGGCCGCGATTGACTTTGTGAGTCAAAGT
R (Nhe)AAAAGCTAGCCCCTACTTTCTATACGATCTGA
ywoBF (Not)AAAAGCGGCCGCTCATGTAAGATTTCCTGACATG
R (Nhe)AAAAGCTAGCCCCTCAGTGTATTATTTGATGT
yrzIF (Not)AAAAGCGGCCGCAGATGTTTACAAAATGGAATTT
R (Nhe)AAAAGCTAGCCACCCCCTTTCAAAGTCCGCAT
ypbGF (Not)AAAAGCGGCCGCAGCCCGGAGCCTCAGCTTATAC
R (Nhe)AAAAGCTAGCCTCTCCATTCTTTTTAGAACTT
ydeKF (Not)AAAAGCGGCCGCCGTTGTTCTCCTAACTGGTATG
R (Nhe)AAAAGCTAGCCACTCCACATATCTTTCTTGTT
yvgSF (Not)AAAAGCGGCCGCAACCGATTTCGAAGTGAAATCG
R (Nhe)AAAAGCTAGCCACCTCCAGAAAATAGTTGACA
expZF (Not)AAAAGCGGCCGCAAAATGAGAGCAGGAGTTTTTT
R (Nhe)AAAAGCTAGCCCCTCGCTTTAAAGGGAGAATA
  • a F, forward primer; R, reverse primer. Restriction sites that were introduced via the oligonucleotides are indicated.

  • b Restriction sites are underlined for the forward primers (NotI) and the reverse primers (NheI).