TABLE 1.

Primers used for PCR in this study

PrimerGeneAmplificationaSize (bp)Nucleotide sequence (5′-3′)
U7-L12 thdF Left junction500ACACCTTGAGCAGGGCAAG
LJ-R1 int AGTTCTAAAGGTTCGTAGTCG
104-RJS044Right junctionTGACGAGCTGAAGCGAATTG
C9-L2 int2 515AGCAAGTGTGCGTAATTTGG
104-D yidY 500ACCAGGGCAAAACTACACAG
cmP01 floR floR 494TTTGGWCCGCTMTCRGACb
cml15 floR SGAGAARAAGACGAAGAAGb
int1 intI1 A1,135GCTCTCGGGTAACATCAAGG
aad aadA2 GACCTACCAAGGCAACGCTA
sulTER sullΔB942AAGGATTTCCTGACCCTG
F3 floR AAAGGAGCCATCAGCAGCAG
F4 floR C598TTCCTCACCTTCATCCTACC
F6 tetR TTGGAACAGACGGCATGG
tetR tetR D1,559GCCGTCCCGATAAGAGAGCA
tetA tet(G)GAAGTTGCGAATGGTCTGCG
int2 groEL-intI1 E1,338TTCTGGTCTTCGTTGATGCC
pse1 pse-1 CATCATTTCGCTCTGCCATT
pse-L pse-1 F4,748AATGGCAATCAGCGCTTCCC
dfrA10-B dfrA10 AACCAACACCACCAATGACA
Forf513orf513G2,144GCAGCACTACCCAGCCTTCA
dfrA10-B dfrA10 AACCAACACCACCAATGACA
dfrA10-A dfrA10 H1,269TGTCATTGGTGGTGTTGGTT
Rsul1 sul1 CGACACCGAGACCAATAGCG
dfrA10-A dfrA10 I3,791TGTCATTGGTGGTGTTGGTT
MDR-BS044GAATCCGACAGCCAACGTTCC
Fresol tnpR TCGGGTCTAGCGGCATTCTT
  • a See Fig. 1.

  • b degenerate nucleotides: M = A or C, R = A or G, S = C or G, W = A or T.