TABLE 2.

Primers used for Northern blot and RT-PCR analysisa

Primer nameSequence
IPF1514 FCTGCAAGTGCATTAAGACAT
IPF1514 RATACGAATCGGACATTTTTC
IPF2857 FF-ATGTTGCGTCAAAGTTTATTC
IPF2857 RCTACATCAAATCTTCTGGTC
IPF4065 FATGGCTAAAACTTCTCCAC
IPF4065 RTTAATTAGCAGCGTCACCATTAC
IPF6629 FATGACTGACGGTAAATTCCC
IPF6629 RTTAATTGTGGATTCTCTTTAAAA
IPF14285 FF-GATCCACCCTTATCACCTAA
IPF14285 RAGTAGCAGAATCTGGTGGTT
CDR1 FGTTGTTTTGGGGAGACCCGGTGCT
CDR1 RCTTACCAGCACCAGATGCTCCCAT
CDR2 FATTCAATTCACGGAAATCGGATA
CDR2 RGTGCACAGTGCACACATTAACC
ERG3 FATCATCTGGTCTTCTGTAAGATTT
ERG3 RAAATTCATTCTTTTCACCGATTGT
IPF2186 FCAACGAGCAAACGTCAGAAA
IPF2186 RCCCAAACCCAAGCAAATCTA
IPF3264 FGACAACTCCCCAAGTTACAT
IPF3264 RAAATCAGCACCTAAGCTTTC
IPF3415 FAACTTGCTAAACAAGGTGGT
IPF3415 RGAATCTAACTTCTCGATGGC
IPF3704 FGCACACGTTTGTCATGGAAC
IPF3704 RACTTGTCGCCAAAGCCTAGA
IPF7817 FTGCTAGAAGAGCTGTTGAAA
IPF7817 RTAATCGTTACCACCAGATGA
IPF7863 FACCGAATTGCCACTTGATTC
IPF7863 RTGTCGATAGCACCAGCAAAG
IPF9538 FCTGGATGCAAATCAAGCAGA
IPF9538 RTTTTGTCAAACGGCCATGTA
IPF17186 FGTACTTTTGGATGGGATGAT
IPF17186 RTTCAGCAACTTGTTTAATGG
CaMDR1 FAAGTCGCACGCGTAAAATGCATTACAGATTTTTAAGAGAT
CaMDR1 RTCAGCGACGCGTCTAATTAGCATACTTAGATCTTGCTCT
CIP1 FATTACAAGAAAAGAACCGGA
CIP1 RGTCATCAGCATTGATACCAG
IFD1 FCGTTGTTGAGAAAGGGTGGGCA
IFD1 RCAATAGTATTCTCCATTTTACC
IFD4 FGGTGCCTCATCTATGAAAACA
IFD4 RCGTTAATCTTATCTGCGTCTCT
IFD7 FAATGATGTTGTCGAAAAGGGA
IFD7 RCAATAGCTTTGTCATTGTCGTT
ERG6 FTATTCCCAATTGACTCATCA
ERG6 RTACCATCACCGACTTCAATA
GPX1 FATGTCTCAATTTTACGAATTAGC
GPX1 RCTTCAACAATTCTTCAATCTTGG
GRP2 FAATCCAGTATATGTATTTGGTCC
GRP2 RCTCAATCTTACTTTCAGCTTTCT
HSP12 FATTTCTACTAAAATCAACGAAGC
HSP12 RGACAACTCCACTCACGTATTC
IFU5 FAAACCCACCACAAGTTCCTG
IFU5 RCTTGGGGCATTAGACCTTGA
RTA3 FTACAGAATGGACTCCTACCT
RTA3 RGCCGTACGATTTAATCGA
SAP3 FCTGATTTATGGGTTCCTGAT
SAP3 RCACCAAAAATAATTTGTCCA
SAP5 FGCTTCTACTGGGCAAATTAT
SAP5 RCTTCACTTTCACGAATACGA
DDR48 FTTTCGGTTTCGGTAAAGACG
DDR48 RTGTCAGTGTTTGAGGAGCCA
EBP1 FGCCTCTAATAAAAGAACCGA
EBP1 RCAAAGTTTCCTTTCCAAATC
EBP4 FTGGAAGAAAATCAATGATGA
EBP4 RCAATTTTTTCAGCACCAACTA
IFR2 FTCAAGCCACTATCAAATACG
IFR2 RAAGCCCTTGAAAAGTTGTAG
MRF1 FGGCGGATATAACGATGCAGT
MRF1 RACTTTCGATTGTGGATTGGC
SNZ1 FCCGGTTTAGCACAAATGCTT
SNZ1 RCCCATCAATTCACCCAAATC
TRX1 FTTCACGTTGTCACTGAAGTT
TRX1 RGAGAAGCCAAAGCTTGTTTA
TTR1 FCAACAATGGTTTCATCTCAA
TTR1 RCAGCTTTGATTTTGTCATCT
IFD2 FGCAACAAGAGATAATTTCCCA
IFD2 RCAAGATGTAATAACTTAAAAG
IFD5 FTGTTGTTGAAAAAGGGTTGACG
IFD5 RCAATAGTTTTATCAGCTTCACG
TEF3 FAGAAACCGTCCACTTGTTGG
TEF3 RGCAAGAAAATGGTGGCAAAT
DFG5 FATAATTGCGGTGGTGGGTTA
DFG5 RCACATGTGACTCCATCGGAC
PHR2 FCTCCAGTTTGGTCTGGTGGT
PHR2 RCGGTTCTGACGGTACCAGAT