TABLE 2.

Primers used to amplify junction region between each plasmid replicon and the blaCMY-2 region

RegionPrimer sequenceaAmplicon size (bp)
pNF1358 upstream junction (type B)For, GTCATCAGACCTGTGCG505
Rev, CGGAAATATCAAACTCGT
pNF1358 downstream junction (type B)For, GTGTATTTCAGGCCAATCGC659
Rev, CTGGGTATTCTCTGGTGCA
pNF4656 upstream junction (type C)For, GACACCTTGCCGTTAATC523
Rev, CGGAAATATCAAACTCGT
pNF4656 downstream junction (type C)For, GCGAGACGCACTCCAGTC1,378
Rev, CTGTTGCAAATAGTCGGTG
pIW759 upstream junction (type D)For, CGCTGAACATGAAAGGA706
Rev, CGGAAATATCAAACTCGT
pIW759 downstream junction (type D)For, GCGAGACGCACTCCAGTC641
Rev, GCTGTATACGCAGTGCTTT
  • a Abbreviations: For; forward primer. Rev; reverse primer.