TABLE 1.

Strains, plasmids, and oligonucleotides used in this study

Strain, plasmid, or oligonucleotideCharacteristics or descriptionReference or source
Strains
    E. coli DH5αφ80lacZΔm15 recA1 endA1 gyrA96 thi-1 hsdR17 (rK, mK+) supE44 relA1 deoR Δ(lacZYA-argF)U169Laboratory stock
    B. subtilis
        CU1065W168 attSPβ trpC2Laboratory stock
        ZB307AW168 SPβ2Δ2::Tn917::pSK10Δ637
        BSF2469CU1065 liaH::pMUTINZoltan Pragai
        BSF2470CU1065 lial::pMUTINZoltan Pragai
        HB0933CU1065 liaR::kan22
        HB0940W168 SPβ2Δ2::Tn917::Φ(PliaI-29-cat-lacZ)This work
        HB0941W168 SPβ2Δ2::Tn917::Φ(PliaI-58-cat-lacZ)This work
        HB0942W168 SPβ2Δ2::Tn917::Φ(PliaI-74-cat-lacZ)This work
        HB0943W168 SPβ2Δ2::Tn917::Φ(PliaI-83-cat-lacZ)This work
        HB0944W168 SPβ2Δ2::Tn917::Φ(PliaI-193-cat-lacZ)This work
        HB0949CU1065 SPβ2Δ2::Tn917::Φ(PliaI-58-cat-lacZ)This work
        HB0950CU1065 SPβ2Δ2::Tn917::Φ(PliaI-74-cat-lacZ)This work
        HB0952CU1065 SPβ2Δ2::Tn917::Φ(PliaI-58-cat-lacZ), liaR::kanThis work
        HB0953CU1065 SPβ2Δ2::Tn917::Φ(PliaI-74-cat-lacZ), liaR::kanThis work
Plasmids
    pJPM122cat-lacZ operon fusion vector for SPβ30
    pSLZ29pJPM122 with PliaI-29This work
    pSLZ58pJPM122 with PliaI-58This work
    pSLZ74pJPM122 with PliaI-74This work
    pSLZ83pJPM122 with PliaI-83This work
    pSLZ193pJPM122 with PliaI-193This work
Oligonucleotidesa
    1312yvqH fwd: GGAGGAATCAGGTATGG
    1314yvqH rev: CTTGACCGCAAATCCTTCC
    1779yvqG fwd: CAACTCTTATCGTCAGGCTTCCG
    1311yvqH-do rev: CGCTAGATCCCCGCTGTCC
    1503PyvqI-559: GGATCTGCAGGGTTTGTGCTGGCGAAAGTCAAGG
    1628yvqI-PE: TTAATAAGAATCCGCCTATTG
    1310yvqH-do fwd: GCAGACCAGACAAAAGCGGC
    1629yvqG-PE: TCCGCTATAATCCGGACATCC
    1506PyvqI-193: CCATCTGCAGGCCAAAGCAGAAAGGTCCGACC
    1507PyvqI-83: CCATCTGCAGCCGGTGCGAGATACGACTCC
    1508PyvqI-74: GGATCTGCAGGATACGACTCCGGTCTTATATAAAAATC
    1509PyvqI-58: GGATCTGCAGTATATAAAAATCAATCTCTGATTCG
    1510PyvqI-29: GGATCTGCAGGCATATCTTCCAACTTG
    1511PyvqI+93: CGATGGATCCTCCTCCAAAAAAGACGGAGATCCC
  • a Numbers and names of the oligonucleotides are according to the Helmann laboratory oligonucleotide collection. Restriction sites are underlined.