TABLE 1.

Nucleotide sequences of primers used for amplification and sequence analysis

PrimeraPositionSequence (5′→3′)Reference or GenBank no.
OXA-60 A2757-2782AAAGGAGTTGTCTCATGCTGTCTCG AF525303
OXA-60 B3605-3579AACCTACAGGCGCGCGTCTCACGGTG AF525303
OXA-60 C2789-2813AAGACCCTCGCGTTTGCCGTGGTGG AF525303
OXA-60 D3552-3529AACTGCTTGCCCAGCGGAATGCGC AF525303
OXA-60 NdeI2757-2782AAAGGAGTTGTCATATGCTGTCTCGb AF525303
OXA-60 BamHI3605-3579AACCTACAGGATCCCGTCTCACGGTG AF525303
OXA-60 NcoI2789-2813AAGACCCTCGCGTTTGCCATGGTGG AF525303
OXA-60 EcoRI3552-3529AACTGCTTGCCCAGCGGAATTCGC AF525303
OXA-60 GSP13020-2997GATCAGGCTGTTCGGAATCTTGAA AF525303
OXA-60 GSP22961-2942CCGGATCGACGACATAGGTA AF525303
OXA-22 RBS1-21GATCGATGATGAAACGCCGC AF064820
OXA-22 BAC804-784TTCCGACAGGCGAGCAAACAG AF064820
OXA-22 NcoI114-137AAGGCCGTCTTCCATGGAGGCAAG AF064820
OXA-22 EcoRI733-713AGGTTGGCGAATTCGTAGGTC AF064820
184NcoI3923-3944TCGCCTTGCGTATAATATTTGC 12
184EcoRI23-6TGATGAATGCTCATCCGG 12
577f23559-577GCGTACCTTTTGTATAATG 43
1622r231622-1605CACCTGTGTCGGTTTGSG 43
  • a Expected sizes of PCR products for primer combinations: OXA-60 A (or OXA-60 NdeI) and OXA-60 B (or OXA-60 BamHI), 848 bp; OXA-60 C (or OXA-60 NcoI) and OXA-60 D (or OXA-60 EcoRI), 763 bp; OXA-22 RBS and OXA-22 BAC, 804 bp; and OXA-22 NcoI and OXA-22 EcoRI, 619 bp.

  • b Restriction sites located in primers are underlined.