TABLE 1.

PCR primers used in this study

GenePrimer sequences (5′-3′)Product size (bp)Reference
blaIMPFor, CTACCGCAGCAGAGTCTTTG58732
Rev, AACCAGTTTTGCCTTACCAT
blaVIMFor, AGTGGTGAGTATCCGACAG26135
Rev, ATGAAAGTGCGTGGAGAC
blaSMEFor, AACGGCTTCATTTTTGTTTAG83027
Rev, GCTTCCGCAATAGTTTTATCA
blaKPCFor, TGTCACTGTATCGCCGTCca. 1,00038
Rev, CTCAGTGCTCTACAGAAAACC
blaIMI/blaNMCFor, CCA TTC ACC CAT CAC AAC440This study (based on GenBank accession no. U50278)
Rev, CTA CCG CAT AAT CAT TTG C
waaEFor, CTG TCG CGT CTG CTA CAG TT851This study (based on GenBank accession no. AF146532)
Rev, CCG GAT AGA TCG CTT TTG TG
qnrFor, GAT AAA GTT TTT CAG CAA GAG G59310
Rev, ATC CAG ATC GGC AAA GGT TA