TABLE 1.

Oligonucleotides used as primers for PCR amplification and sequencing

PrimerTargetSequence (5′-3′)Accession no.
IMP1F bla IMP-likeTGAGCAAGTTATCTGTATTC AJ223604
IMP1R bla MP-1 59-beGCTGCAACGACTTGTTAG AJ223604
ATT1F attI1 TTATGGAGCAGCAACGATGT AJ515707
VIMR bla VIM-likeCGAATGCGGCAGCACCAGG AJ515707
SPM1F bla SPM-likeCCTACAATCTAACGGCGACC AJ492820
SPM1R bla SPM-likeTCGCCGTGTCCAGGTATAAC AJ492820
intl1FIntegraseGCCGTAGAAGAACAGCAAGG AJ515707
intl2FIntegraseTCAATCTCCGCGAGAAGTGC AJ515707
ATT1R attI1 GCCTGTTCGGTTCGTAAGCT AJ515707
GIMF bla GIM-1 AGAACCTTGACCGAACGCAGThis study
GIMR bla GIM-1 ACTCATGACTCCTCACGAGGThis study
GIMFF bla GIM-1 flanking regionCTACGTGACCAACAGCAACGThis study
aacA4F aacA4 TGCGATGCTCTATGAGTGGC AJ515707
aacA4R aacA4 ATGTACACGGCTGGACCATC AJ515707
aacA4FF aacA4 flanking regionAACTTGCGAGCGATCCGATG AJ515707
aacA4FR aacA4 flanking regionAGCCACTCATAGAGCATCGC AJ515707
aadA1F aadA1 CGCCGAAGTATCGACTCAAC AJ584652
IS1394RIS1394ACAGAGGTAGTGGCGTTGC U37284
ISFIS1394CGGTCTTCTGGGTGATTTCC U37284
ISFRIS1394CGCGCTTAGCTGGATAACG U37284
aadA1R aadA1 GACTACCTTGGTGATCTCGC AJ584652
aadA1FF aadA1 flanking regionGAGATCACCAAGGTAGTCGG AJ584652
oxa2F bla OXA-2 TTCAAGCCAAAGGCACGATAG AF300985
oxa2R bla OXA-2 TCCGAGTTGACTGCCGGGTTG AF300985
oxa2FF bla OXA-2 flanking regionAAGCGTTACCGCCCAACC AF300985
oxa2FR bla OXA-2 flanking regionATGCGCGAAAGTGGCAAGAG AF300985
QACR qacEΔ1CGGATGTTGCGATTACTTCG AJ515707
SUL2R sul1 GGCTCTCATCGAAGAAGGAG AJ515707
Sul1R sul1 GGCTCTCATCGAAGAAGGAG AJ515707