TABLE 1.

Oligonucleotides used as primers for PCR amplification and sequencing

PrimerTargetSequence (5′-3′)Accession no.
IMP1FblaIMP-likeTGAGCAAGTTATCTGTATTCAJ223604
IMP1RblaMP-1 59-beGCTGCAACGACTTGTTAGAJ223604
ATT1FattI1TTATGGAGCAGCAACGATGTAJ515707
VIMRblaVIM-likeCGAATGCGGCAGCACCAGGAJ515707
SPM1FblaSPM-likeCCTACAATCTAACGGCGACCAJ492820
SPM1RblaSPM-likeTCGCCGTGTCCAGGTATAACAJ492820
intl1FIntegraseGCCGTAGAAGAACAGCAAGGAJ515707
intl2FIntegraseTCAATCTCCGCGAGAAGTGCAJ515707
ATT1RattI1GCCTGTTCGGTTCGTAAGCTAJ515707
GIMFblaGIM-1AGAACCTTGACCGAACGCAGThis study
GIMRblaGIM-1ACTCATGACTCCTCACGAGGThis study
GIMFFblaGIM-1 flanking regionCTACGTGACCAACAGCAACGThis study
aacA4FaacA4TGCGATGCTCTATGAGTGGCAJ515707
aacA4RaacA4ATGTACACGGCTGGACCATCAJ515707
aacA4FFaacA4 flanking regionAACTTGCGAGCGATCCGATGAJ515707
aacA4FRaacA4 flanking regionAGCCACTCATAGAGCATCGCAJ515707
aadA1FaadA1CGCCGAAGTATCGACTCAACAJ584652
IS1394RIS1394ACAGAGGTAGTGGCGTTGCU37284
ISFIS1394CGGTCTTCTGGGTGATTTCCU37284
ISFRIS1394CGCGCTTAGCTGGATAACGU37284
aadA1RaadA1GACTACCTTGGTGATCTCGCAJ584652
aadA1FFaadA1 flanking regionGAGATCACCAAGGTAGTCGGAJ584652
oxa2FblaOXA-2TTCAAGCCAAAGGCACGATAGAF300985
oxa2RblaOXA-2TCCGAGTTGACTGCCGGGTTGAF300985
oxa2FFblaOXA-2 flanking regionAAGCGTTACCGCCCAACCAF300985
oxa2FRblaOXA-2 flanking regionATGCGCGAAAGTGGCAAGAGAF300985
QACRqacEΔ1CGGATGTTGCGATTACTTCGAJ515707
SUL2Rsul1GGCTCTCATCGAAGAAGGAGAJ515707
Sul1Rsul1GGCTCTCATCGAAGAAGGAGAJ515707