TABLE 2.

Oligonucleotides used as primers for PCR amplification of β-lactam and aminoglycoside resistance genes

Gene(s)PrimerSequence (5" to 3")aReference
bla TEM-1 TEM-A2GTATCCGCTCATGAGACAATA39
TEM-extTCTAAAGTATATATGAGTAAAC
bla SHV-1 OS0CTCGCCTTTATCGGCCCTCAC2
OS5CGGCCACGCGGGTTAGCG
bla OXA-10, -11, -14, -16, -17 OPR1GTCTTTCGAGTACGGCATTA44
OPR2ATTTTCTTAGCGGCAACTTAC
bla PER-1 PER-AATGAATGTCATTATAAAAGC28
PER-1BAATTTGGGCTTAGGGCAGAA
bla VEB-1 VEB-FCGACTTCCATTTCCCGATGC25
VEB-BGGACTCTGCAACAAATACGC
bla GES-1 GES-1AATGCGCTTCATTCACGCAC32
GES-1BCTATTTGTCCGTGCTCAGG
bla OXA-13 OXA-13.1GCCGCATATGTAATTACTGC24
OXA-13.2ATTTTCTTAGCGGCAACTTAT
bla OXA-18 OXA-18FATTTCAACGGTTTGCCTTACG30
OXA-18BTTGGCATCGGAAAGCGAACC
aac(3)-Ib 5" AAC3CATCATAGGAGGTTGTTTGATGTTATGGAGCAGThis study
3" AAC3TTATTATGGATCAATGTCGAAGTGCAThis study
aac(6")-Ib"5" AAC6"CATCATAGGAGGTGATCCAATGACCAACAGCAACGATTCCGThis study
3" AAC6"CCTCGATGGAAGGGTTAGGCThis study
  • a The RBS and start and stop codons are underlined in the primers where they were included.