TABLE 2.

Oligonucleotides used as primers for PCR amplification of β-lactam and aminoglycoside resistance genes

Gene(s)PrimerSequence (5" to 3")aReference
blaTEM-1TEM-A2GTATCCGCTCATGAGACAATA39
TEM-extTCTAAAGTATATATGAGTAAAC
blaSHV-1OS0CTCGCCTTTATCGGCCCTCAC2
OS5CGGCCACGCGGGTTAGCG
blaOXA-10, -11, -14, -16, -17OPR1GTCTTTCGAGTACGGCATTA44
OPR2ATTTTCTTAGCGGCAACTTAC
blaPER-1PER-AATGAATGTCATTATAAAAGC28
PER-1BAATTTGGGCTTAGGGCAGAA
blaVEB-1VEB-FCGACTTCCATTTCCCGATGC25
VEB-BGGACTCTGCAACAAATACGC
blaGES-1GES-1AATGCGCTTCATTCACGCAC32
GES-1BCTATTTGTCCGTGCTCAGG
blaOXA-13OXA-13.1GCCGCATATGTAATTACTGC24
OXA-13.2ATTTTCTTAGCGGCAACTTAT
blaOXA-18OXA-18FATTTCAACGGTTTGCCTTACG30
OXA-18BTTGGCATCGGAAAGCGAACC
aac(3)-Ib5" AAC3CATCATAGGAGGTTGTTTGATGTTATGGAGCAGThis study
3" AAC3TTATTATGGATCAATGTCGAAGTGCAThis study
aac(6")-Ib"5" AAC6"CATCATAGGAGGTGATCCAATGACCAACAGCAACGATTCCGThis study
3" AAC6"CCTCGATGGAAGGGTTAGGCThis study
  • a The RBS and start and stop codons are underlined in the primers where they were included.