TABLE 2.

Primers used in this study

PrimerSequence (5′ to 3′)Reference(s)Description
U7-L12ACACCTTGAGCAGGGCAAG 4, 5Left-junction PCR
LJ-R1AGTTCTAAAGGTTCGTAGTCG 4, 5Left-junction PCR
104-RJTGACGAGCTGAAGCGAATTG 4, 5Right-junction PCR
C9-L2AGCAAGTGTGCGTAATTTGG 4, 5Right-junction PCR
104-DACCAGGGCAAAACTACACAG 4, 5Right-junction PCR
aadA2-LTGTTGGTTACTGTGGCCG 29 aadA2 probe
aadA2-R2TGCTTAGCTTCAAGTAAGACGThis study aadA2 probe
StCM-LCACGTTGAGCCTCTATATGGThis study floR probe
St-CM-RATGCAGAAGTAGAACGCGACThis study floR probe
tetG-LCAGCTTTCGGATTCTTACGG 29 tet(G) probe
tetG-RGATTGGTGAGGCTCGTTAGC 29 tet(G) probe
pse-LAATGGCAATCAGCGCTTCCC 29 pse-1 probe
pse-R2ACAATCGCATCATTTCGCTCThis study pse-1 probe
QS-1ATGAAAGGCTGGCTTTTTCTTG 4 qac/sul1 probe
QS-2TGAGTGCATAACCACCAGCC 4 qac/sul1 probe
DB-T1TGCCACGCTCAATACCGACThis studyIS6100/S044 probe
MDR-BGAATCCGACAGCCAACGTTCCThis studyIS6100/S044 probe
MDR-7AACCGTGCATCTATCGAGCThis study
F6TTGGAAACAGACGGCATGG 10