TABLE 4

Primers used in this study

PrimerNucleotide sequence (5′–3′)a
axyZ-FATGCGCTTGGACAGYGACGA
axyZ-RCGGATRCGARTGCGAGCGTT
Screen-deltaAxyZ-FTTGGAAGGAATATGGCAACG
Screen-deltaAxyZ-RACGTAGATCGGGTCGAGTTG
Seq-deltaAxyZ-1CCCTCAAGCAACTCGAAGC
Seq-deltaAxyZ-2GCTTCGAGTTGCTTGAGGG
Seq-deltaAxyZ-3CGCCAGCATACTTTTGAACA
Seq-deltaAxyZ-4TGTTCAAAAGTATGCTGGCG
axyY-qPCR-F3TGTATTCGGTCAACGGCTTC
axyY-qPCR-R4GCGCGAACACCATCAGGTT
rpsl-qPCR-1FACGCACTTTGGCAACCTTAC
rpsl-qPCR-1RGCGAAGTCAGCATCATCAAA
rpoD-qPCR-F1AAGGACGGCTACAAGTCGGA
rpoD-qPCR-R1GCCAGCTTCTCGACCATCTT
  • a The nucleotide base code for degenerate primers is as follows: Y is C or T; R is A or G.