TABLE 1.

PCR primers for identification and characterization of integron and gene cassettes

Primer no.Primer namePrimer sequence (5′ → 3′)Accession no.
115ACCGCCAACTTTCAGCACAT M95287
213GCGTTCGGTCAAGGTTCTGG M95287
35′-CSGGCATCCAAGCAGCAAGC M73189
43′-CSAAGCAGACTTGACCTGAT M73189
5qacEΔ1FATCGCAATAGTTGGCGAAGT X15370
6qacEΔ1BCAAGCTTTTGCCCATGAAGC X15370
7Sul1FCTTCGATGAGAGCCGGCGGC X12869
8Sul1BGCAAGGCGGAAACCCGCGCC X12869
9Oxa2-ACCTGCATCGACATTCAAGATA P05191
10Oxa2-BCTCAACCCATCCTACCCACCA P05191
11Bla1TTAATGATGACTCAGAGCATT X92507
12Bla2GATACCTCGCTCCATTTATTGC X92507
13Bla4TACCCAACCGGAGCAGAAGG X92507
14Bla-upGGCTTCCAGCTGCTGTTGCACThis work
15Bla-downTTGACTGTCGACCCCAAATCCThis work
16ORFendCCGTTAAGCTCTTATGTGGG L06418