TABLE 1.

PCR primers for identification and characterization of integron and gene cassettes

Primer no.Primer namePrimer sequence (5′ → 3′)Accession no.
115ACCGCCAACTTTCAGCACATM95287
213GCGTTCGGTCAAGGTTCTGGM95287
35′-CSGGCATCCAAGCAGCAAGCM73189
43′-CSAAGCAGACTTGACCTGATM73189
5qacEΔ1FATCGCAATAGTTGGCGAAGTX15370
6qacEΔ1BCAAGCTTTTGCCCATGAAGCX15370
7Sul1FCTTCGATGAGAGCCGGCGGCX12869
8Sul1BGCAAGGCGGAAACCCGCGCCX12869
9Oxa2-ACCTGCATCGACATTCAAGATAP05191
10Oxa2-BCTCAACCCATCCTACCCACCAP05191
11Bla1TTAATGATGACTCAGAGCATTX92507
12Bla2GATACCTCGCTCCATTTATTGCX92507
13Bla4TACCCAACCGGAGCAGAAGGX92507
14Bla-upGGCTTCCAGCTGCTGTTGCACThis work
15Bla-downTTGACTGTCGACCCCAAATCCThis work
16ORFendCCGTTAAGCTCTTATGTGGGL06418