TABLE 2.

Primers used in the multiplex PCR

LocusPrimerOligonucleotide sequence (5′-3′)LocationAmplicon size (bp)Specificitye (SCCmec type)
ACIF2 F2TTCGAGTTGCTGATGAAGAAGG18398-18419a495I
CIF2 R2ATTTACCACAAGGACTACCAGC18892-18871a
BKDP F1AATCATCTGCCATTGGTGATGC10445-10467b284II
KDP R1CGAATGAAGTGAAAGAAAGTGG10728-10707b
CMECI P2ATCAAGACTTGCATTCAGGC42428-42447b209II, III
MECI P3GCGGTTTCAATTCACTTGTC42636-42617b
DDCS F2CATCCTATGATAGCTTGGTC38011-37992a342I, II, IV
DCS R1CTAAATCATAGCCATGACCG37670-37689a
ERIF4 F3GTGATTGTTCGAGATATGTGG45587-45607c243III
RIF4 R9CGCTTTATCTGTATCTATCGC45829-45809c
FRIF5 F10TTCTTAAGTACACGCTGAATCG59573-59594c414III
RIF5 R13GTCACAGTAATTCCATCAATGC59986-59965c
GIS431 P4CAGGTCTCTTCAGATCTACG49963-49982b381
pUB110 R1GAGCCATAAACACCAATAGCC50343-50323b
HIS431 P4CAGGTCTCTTCAGATCTACG29654-29673c303
pT181 R1GAAGAATGGGGAAAGCTTCAC29976-29956c
mecAMECA P4TCCAGATTACAACTTCACCAGG1190-1211d162Internal control
MECA P7CCACTTCATATCTTGTAACG1351-1332d
  • a Relative to accession no. AB033763, SCCmec type I (13).

  • b Relative to accession no. D86934, SCCmec type II (12).

  • c Relative to accession no. AB037671, SCCmec type III (12).

  • d Relative to accession no. Y00688, mecA gene (34).

  • e Loci G and H were included to distinguish variants IA from I and IIIA from III, respectively.