Primers used in the multiplex PCR

LocusPrimerOligonucleotide sequence (5′-3′)LocationAmplicon size (bp)Specificitye (SCCmec type)
mecA MECA P4TCCAGATTACAACTTCACCAGG1190-1211d162Internal control
  • a Relative to accession no. AB033763 , SCCmec type I (13).

  • b Relative to accession no. D86934 , SCCmec type II (12).

  • c Relative to accession no. AB037671 , SCCmec type III (12).

  • d Relative to accession no. Y00688 , mecA gene (34).

  • e Loci G and H were included to distinguish variants IA from I and IIIA from III, respectively.