TABLE 1.

PCR parametersa

PrimerSequence (5′ to 3′)
16SFGCTAATACCGCATAACGTCG
16SRTAGCTGGTCTGAGAGGATGA
marAFATCGAGGACAACCTGGAATC
marARCATTAGGCCAATACATCCGC
soxSFCGCATGGATTGACGAGCATA
soxSRTGATATCGCAATGGACCTGG
acrBFCATGACGCAGGAGGATATCT
acrBRGGTGGTGAGAACTACGACAT
  • a The annealing temperature was 56°C, the extension time was 1 min, and the primer concentration was 25 μM.