TABLE 2.

PCR primers used to determine the context of the blaCMY-2 sequence

Primer pairSequence (5′→3′)Expected size (bp)Reference or source
CMY-2-LCCGCTGAAAGCTGATTCGAT5,384This study
pNF4656down-RCTGTTGCAAATAGTCGGTG10
CMY-2-LCCGCTGAAAGCTGATTCGAT8,957This study
TraC-RGGTGCCGTAATCGAAGATTTThis study
DsbC-LTTTTGTATCGCGCTGGAATT3,863This study
CMY-2-RCGTAACTCATTCCTGAGGGTTThis study
pNF4656down-LGCGAGACGCACTCCAGTC3,74210
pNF4656down-RCTGTTGCAAATAGTCGGTG10
pNF4656up-LGACACCTTGCCGTTAATC53810
pNF4656up-RCGGAAATATCAAACTCGT10
TnpA1-LATCAGCTTTTATGACTCGAT3,449This study
Blc-RATTGGTCTGAAGCTGAGCACTThis study
TnpA2-LGCCACTATCCATTCGAAATAAA3,253This study
Blc-RATTGGTCTGAAGCTGAGCACTThis study