TABLE 2.

Primers used in this study

PrimerSequence (5′-3′)aLocation (GenBank accession no. NC_002951) or reference
capA167AGGGTGACAATCCTCAGTTTATGG153571-153594
capA501GACTTTAACTGCTGTACCGTCTGCT153881-153905
capA710TTGAACCCAATACAGGCAATCC154035-154056
ccpA-FCAGCATCCATTGCACTATGC1830520-1830539
ccpA-RTCTCTATGGCCACAGTGTCG1831235-1831254
ccpABamHI-FgcggatccTAGAATTGCAACAGGTGACG1829196-1829215
ccpAEcoRI-RgcgaattCTGTTGCACTTAGTGATGCG1831924-1831943
ccpAko-FAATTTCCTCCTTGTAAACG1831295-1831313
ccpAko-RATGGGTGTTGGAAGAATGCC1830246-1830265
gyr297TTAGTGTGGGAAATTGTCGATAAT20
gyr574AGTCTTGTGACAATGCGTTTACA20
gyr864GTACGATTTAATACCGCCCTCATA20
hla-FAGAAAATGGCATGCACAAAAA50
hla-RTGTAGCGAAGTCTGGTGAAAA50
MST12gagtctagaACCAACTGCGAAAGCAGC1831994-1832011
MST14gaggatccGGCATTCTTCCAACACCCA1830246-1830264
pckA-FCCATCAACTTCTGGATCTGC1893626-1893645
pckA-RGGATGTCAGTAGACACATAC1893129-1893148
RNAIII-FGTGATGGAAAATAGTTGATGAG5
RNAIII-RGTGAATTTGTTCACTGTGTCG5
spa-FTgAATTCGTAAACTAGGTGTAGG46
spa-RcggTaCCAGGCTTGTTATTGTCTTCC46
tetL-FCCTGTTATAAAAAAAGGATC17
tetL-RCCATATTGTTGTATAAGTG17
T7-capA59taatacgactcactatagggagAATGGAAAGTACATTAGAA153404-153422
T7-gyrtaatacgactcactatagggagATTATGGTGCTGGGCAAATACA20
  • a Lowercase letters represent nucleotide additions.