TABLE 2.

Oligonucleotide primers used in this study

NameNucleotide sequence (5′-3′)Location/useNo. as referred to in Fig. 1a
OXA-58ACGATCAGAATGTTCAAGCGCblaOXA-581
OXA-58BACGATTCTCCCCTCTGCGCblaOXA-582
ISAba1AGTGCTTTGCGCTCATCATGCtnpA of ISAba116
ISAba1BCATGTAAACCAATGCTCACCtnpA of ISAba117
ISAba2AAATCCGAGATAGAGCGGTTCtnpA of ISAba212
ISAba2BTGACACATAACCTAGTGCACtnpA of ISAba213
ISAba3ACAATCAAATGTCCAACCTGCtnpA of ISAba33
ISAba3BCGTTTACCCCAAACATAAGCtnpA of ISAba3 but not in ISAba3-like4
ISAba3CAGCAATATCTCGTATACCGCtnpA of ISAba3-like and ISAba311
IS18ACACCCAACTTTCTCAAGATGtnpA of IS1814
IS18BACCAGCCATAACTTCACTCGtnpA of IS1815
PreThATCCAACCATTCATCAAACTCTGGCLeft-hand extremity of Re27-16
PreEtCTATTTGGTTTTAAGGGGCRight-hand extremity of Re27-25
Re27-1TTCGTATAACCGCCATTATGInside the Re27-1 sequence7
Re27-2AACATAATGGCTGTTATACGInside the Re27-2 sequence8
MAD-ThAACAGCAATAGCCATCAACThr-Eff gene9
SM2AAGTGTCTATATTCTCACCBetween Re27-1 and ISAba-3-like10
AAPGGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIGUsed for 5′-RACE-
AUAPGGCCACGCGTCGACTAGTACUsed for 5′-RACE-
OXA-58-5′extCGACTCATACTATGCTCAGCUsed for 5′-RACE-
  • a -, primer not indicated in Fig. 1.