TABLE 2.

Oligonucleotide primers used in this study

NameNucleotide sequence (5′-3′)Location/useNo. as referred to in Fig. 1a
OXA-58A CGATCAGAATGTTCAAGCGC bla OXA-58 1
OXA-58B ACGATTCTCCCCTCTGCGC bla OXA-58 2
ISAba1A GTGCTTTGCGCTCATCATGC tnpA of ISAba116
ISAba1B CATGTAAACCAATGCTCACC tnpA of ISAba117
ISAba2A AATCCGAGATAGAGCGGTTC tnpA of ISAba212
ISAba2B TGACACATAACCTAGTGCAC tnpA of ISAba213
ISAba3A CAATCAAATGTCCAACCTGC tnpA of ISAba33
ISAba3B CGTTTACCCCAAACATAAGC tnpA of ISAba3 but not in ISAba3-like4
ISAba3C AGCAATATCTCGTATACCGC tnpA of ISAba3-like and ISAba311
IS18A CACCCAACTTTCTCAAGATG tnpA of IS1814
IS18B ACCAGCCATAACTTCACTCG tnpA of IS1815
PreTh ATCCAACCATTCATCAAACTCTGGC Left-hand extremity of Re27-16
PreEt CTATTTGGTTTTAAGGGGC Right-hand extremity of Re27-25
Re27-1 TTCGTATAACCGCCATTATG Inside the Re27-1 sequence7
Re27-2 AACATAATGGCTGTTATACG Inside the Re27-2 sequence8
MAD-Th AACAGCAATAGCCATCAAC Thr-Eff gene9
SM2 AAGTGTCTATATTCTCACC Between Re27-1 and ISAba-3-like10
AAP GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG Used for 5′-RACE-
AUAP GGCCACGCGTCGACTAGTAC Used for 5′-RACE-
OXA-58-5′ext CGACTCATACTATGCTCAGC Used for 5′-RACE-
  • a -, primer not indicated in Fig. 1.