TABLE 1.

Oligonucleotides used in the amplification of the four alleles of the peptidyltransferase region in domain V of the 23S rRNA

DesignationPCR primer sequence (5′ to 3′)Posi- tionaProduct size (bp)
gonrRNA-FACGAATGGCGTAACGATGGCCACA1954712
gonrRNA-R2TTCGTCCACTCCGGTCCTCTCGTA2665
rRNA (allele 1)TCAGAATGCCACAGCTTACAAACT+11162,054
rRNA (allele 2)GCGACCATACCAAACACCCACAGG+13022,240
rRNA (allele 3)GATCCCGTTGCAGTGAAGAAAGTC+12792,217
rRNA (allele 4)AACAGACTTACTATCCCATTCAGC+9091,847
  • a Primer positions were determined from the N. gonorrhoeae FA1090 contig (Gonococcal Genome Sequencing Project, University of Oklahoma); allele-specific primers are downstream of the 23S rRNA.