TABLE 1.

H. pylori genes potentially involved in tetracycline resistancea

Putative function of selected gene product (gene name)Gene no. (aa in ORF)Primer sequence (5′-3′)bExpected product size (bp)cPCR programd
TIGR 26695J99ForwardReverse
Membrane proteins
    GTP-binding membrane protein (lepA)HP0355 (602)JHP0329 (604)AGAGTTTGACTGACGCTATTTTTGCCATAGAAGCTAAACG1,87495°C for 30 s, 50°C for 30 s, 72°C for 2 min 30 s
    GTP-binding membrane protein, fusA homolog (yihK)HP0480 (599)JHP0432 (599)CGCCATTTGGGGCTATTATCCTACAGCTAAAGACTTGCC2,01895°C for 30 s, 50°C for 30 s, 72°C for 2 min 30 s
    α-Ketoglutarate permease (kgtP)HP1091 (426)JHP0334 (437)TCCCTTTTAGCCGCTAGTTCATGACATAGCCCACAAACCC1,18195°C for 30 s, 52°C for 30 s, 72°C for 2 min
    Tetracycline resistance protein (tetA)HP1165 (386)JHP1092 (386)GCAGTCATTCGCTAATTCAAAACGGCTTAGCCTTATACAA1,41895°C for 30 s, 55°C for 30 s, 72°C for 2 min
    Multidrug-efflux transporterHP1181 (443)JHP1107 (443)TTTCCATTAGCGTTAGTGTCCTAAAGTTTTGCGCTAAGTG1,31095°C for 30 s, 55°C for 30 s, 72°C for 2 min
    Conserved hypothetical integral membrane proteinHP1185 (391)JHP1111 (391)CCAAAAGAGCGCCAACAAACCTTGCGTGTGGTAGTAATGC1,60195°C for 30 s, 55°C for 30 s, 72°C for 2 min
    Protein export membrane protein (secD)HP1550 (503)JHP1449 (526)CACCCCATAATTGGAATAACCTAGAAACTAAAGGCCCTAA1,56895°C for 30 s, 50°C for 30 s, 72°C for 2 min 30 s
Cytoplasmic proteins
    Translation initiation factor IF-2 (infB)HP1048 (944)JHP0377 (949)CGCTAAAGCCTCTTGCAGTATGATTGGCAAAGGCCGTAGTT3,04195°C for 30 s, 50°C for 30 s, 72°C for 3 min 45 s
    Translation elongation factor EF-G (fusA)HP1195 (692)JHP1118 (692)TTGCTAGGCACTTCGCCATAATGGATGCGGCTAGCGATAA2,15295°C for 30 s, 55°C for 30 s, 72°C for 2 min 30 s
    Translation elongation factor EF-Tu (tufB)HP1205 (399)JHP1128 (399)TCAGAACACTTCAACCCTAGTTTCCCGCTCCATTTTTA1,51195°C for 30 s, 55°C for 30 s, 72°C for 2 min
16S rRNA (rrnA and rrnB)eTTTATGGAGAGTTTGATCCTAGGAGGTGATCCAACCGCA1,49495°C for 30 s, 55°C for 1 min, 72°C for 2 min
  • a Genes were selected from the published H. pylori genomes as potential Tetr candidate genes, based on their homology with tetracycline resistance genes in other bacteria.

  • b Primers used for amplification were based on the published genome sequences of H. pylori strains 26695 (23) and J99 (1).

  • c Fragment length is based on the genome sequence of H. pylori strain 26695 (23).

  • d The PCR amplification cycle was repeated 35 times and followed by a 10-min extension step at 72°C.

  • e The primers used for amplification of the 16S rRNA genes did not distinguish between the two copies present on the chromosome.