TABLE 2.

Primers used in this work

PrimerSequence (5′-3′)aPCR product size (bp)Use
ADh2-FBHITCGGATCCGCCTGACCGCGCTGCCC815Cloning of ampDh2
ADh2-RBHITCGGATCCTCAGGAAGTCGGCACCGCC
ADh3-FBHITCGGATCCCTTGGCCGGCCCCTGAAC960Cloning of ampDh3
ADh3-RBHITCGGATCCGCGACGACCTGAGCGACG
AD-F0ERITCGAATTCGTCCTGACTTCGCCGGAC523AmpD inactivation
AD-R3HDIIITCAAGCTTCACGGACCCAGCCGGTAAC
AD-F2HDIIITCAAGCTTGCCTGGACCCGAACGAAC512
AD-RBHITCGGATCCGAGGGCAGATCCTCGACCAG
ADh2-FBHITCGGATCCGCCTGACCGCGCTGCCC470AmpDh2 inactivation
ADh2-R2HDIIITCAAGCTTGATGCCGTGGCGCTTGGC
ADh2-F3HDIIITCAAGCTTGGAAGCGCCTCGCCGACG438
ADh2-R0ERITCGAATTCGGACGCAAGAAGGGCGGC
ADh3-FBHITCGGATCCCTTGGCCGGCCCCTGAAC443AmpDh3 inactivation
ADh3-R3HDIIITCAAGCTTGTCGGGGAAGGTGAACACG
ADh3-F3HDIIITCAAGCTTGAAGAACGTGGTCGGCCAC443
ADh3-RERITCGAATTCGCGACGACCTGAGCGACG
ACrnaFGGGCTGGCCTCGAAAGAGGAC246Quantification of ampC mRNA
ACrnaRGCACCGAGTCGGGGAACTGCA
ADrnaFCGCGCATTTCCTCATCGAACGC251Quantification of ampD mRNA
ADrnaRTCGCAGTGGCCCTGGATGCG
AErnaFCCGCTGCACCTTCTGGTGGTG246Quantification of ampE mRNA
AErnaRGCCACCGGGCCGAGCAAGGCA
ADh2rnaFTCGCTGGGCATCCTCACCCAC248Quantification of ampDh2 mRNA
ADh2rnaRTCAGCGCCTGGATCTGTGCTTC
ADh3rnaFTGGTGCTGCACTACACCGCGC246Quantification of ampDh3 mRNA
ADh3rnaRCGAGGTTGACGATCTCGATGCC
  • a Sites for restriction endonucleases are underlined. Primer sequences were obtained from the published PAO1 genome (40).