TABLE 1.

DNA sequences used in the real-time RT-PCR experiments and regulatory gene characterization studies

Study and genePrimer or probePrimer or probeReference
Real-time RT-PCR experiments
    rpoDFor5′-GGGCTGTCTCGAATACGTTGA-3′This study
Rev5′-ACCTGCCGGAGGATATTTCC-3′
Probe[DFAM]TGCGGATGATGTCTTCCACCTGTTCC[DTAM]
ampCFor5′-CGCCGTACAACCGGTGAT-3′This study
Rev5′-CGGCCGTCCTCTTTCGA-3′
Probe[DFAM]TCAGCCTGAAAGGAGAACCGCATTACTTC[DTAM]
oprDaFor5′-CTACGGCTACGGCGAGGAT-3′This study
Rev5′-GACCGGACTGGACCACGTACT-3′
Probe[DFAM]CACCACGAAACCAACCTCGAAGCC[DTAM]
mexAFor5′-AACCCGAACAACGAGCTG-3′This study
Rev5′-ATGGCCTTCTGCTTGACG-3′
Probe[DFAM]CATGTTCGTTCACGCGCAGTTG[DTAM]
mexCFor5′-GGAAGAGCGACAGGAGGC-3′This study
Rev5′-CTGCACCGTCAGGCCCTC-3′
Probe[DFAM]CCGAAATGGTGTTGCCGGTG[DTAM]
mexEFor5′-TACTGGTCCTGAGCGCCT-3′This study
Rev5′-TCAGCGGTTGTTCGATGA-3′
Probe[DFAM]CGGAAACCACCCAAGGCATG[DTAM]
mexXFor5′-GGCTTGGTGGAAGACGTG-3′This study
Rev5′-GGCTGATGATCCAGTCGC-3′
Probe[DFAM]CCGACACCCTGCAGGGCC[DTAM]
Regulatory gene characterization studies
ampRC2For5′-CTCGAGAGCGAGATCGTTGCGGCACG-3′3
amprRC1Rev5′-GTCGACCAGTGCCTTCAGGCGATCC-3′
mexRFor5′-TGTTCTTAAATATCCTCAAGCGG-3′This study
Rev5′-GTTGCATAGCGTTGTCCTCA-3′
nalCFor5′-TCAACCCTAACGAGAAACGCT-3′This study
Rev5′-TCCACCTCACCGAACTGC-3′
nalDFor5′-GCGGCTAAAATCGGTACACT-3′42
Rev5′-ACGTCCAGGTGGATCTTGG-3′
mexTFor5′-AAAACCACCCGTCGTTATTG-3′This study
Rev25′-CAGTTCGTCGGTGTAGCTGA-3′
For25′-TCAGCTACACCGACGAACTG-3′
Rev5′-GGGATGACTGTTCCAT-3′
mexZFor5′-ATTGGATGTGCATGGGTG-3′43
Rev5′-TGGAGATCGAAGGCAGC-3′
  • a For two isolates with nonamplifiable oprD, the nucleotide sequence corresponding to the forward primer was (changes underlined) GGGCCTCTACGGCGAGGAC; that corresponding to the reverse primer was GGCCGGCCTGGACGACGTACT; and that corresponding to the probe was CACCACGAGACCAACCTGGAAGCC.