TABLE 2.

Oligonucleotide primers and PCR products used in this study

Primer5′-3′ primer sequenceProduct length (bp)
rpoB amplificationa
    rpoB-1FwdAGCGGATCACATAATTTTTGAGGGG977
    rpoB-1RevTTTTACGACGATCAAGCACTGTACC
    rpoB-2FwdGTGAACCACCAACTGTTGAAAATGC1,047
    rpoB-2RevCAACTTCATCATCCATGAAACGACC
    rpoB-3FwdTGACGTTCACTACTCTCACTATGGC1,077
    rpoB-3RevGCATGTAACAATCTTTCTTCGGCAG
    rpoB-4FwdCTAAGTTAGGACCTGAAGAAATCAC953
    rpoB-4RevGTTTTCACCTTTAACAATAGCCTCG
    rpoB-5FwdGAAGAAGATATGCCTTACTTACCAG1,063
    rpoB-5RevGTATTTACCACAACTACATTCCCAG
Additional rpoB primers for sequence determination
    rpoB-1RevSGCTTGTTCAGTGTTTTCAGTG
    rpoB-2RevSGCCATAGTGAGAGTAGTGAACG
    rpoB-3RevSCATGATAACGGCATCCTCATAG
    rpoB-4RevSAATATGGTCCTGTTGAACGC
    rpoB-5FwdSAAGAAGCTGGTATGGCTCG
rpoC amplificationa
    rpoC-1FwdCCAAGTGTTCCAGAATCATTCCG1,070
    rpoC-1RevATCGTCCACCATCTAATTGAACC
    rpoC-2FwdCCAATCATCCCACCAGAAATTCG998
    rpoC-2RevTTACCTACTGACGTAGCAAGAATC
    rpoC-3FwdATGCAGTAAATACAGGCGCAATC950
    rpoC-3RevAGTACCACAGTCTTCTTCACGAAC
    rpoC-4FwdCAGTTGTTGAAATTTGGACAGATGC985
    rpoC-4RevGAACCTTCAGTTAATACTTCACCAC
    rpoC-5FwdAACCAGGTACACAGCTTACAATG959
    rpoC-5RevTTATCCTCCAAAGTTCTGCTTGC
    rpoC-6FwdAACCTGAAACAATCAACTACCG820
    rpoC-6RevCGACCACGACGACCATTATC
Additional rpoC primers for sequence determination
    rpoC-1FwdSACGCAATTTACAAAACAGGC
    rpoC-2RevSGTTTTGTGCTGCTAACATCAAC
    rpoC-3RevSACGGAATGAAGATGTGATTGG
    rpoC-4FwdSTCATTCCGTGAAGGTTTAACAG
    rpoC-5RevSCGTATTTTACGTCGCTATAACG
yycF and yycG amplificationa
    yycFG-1FwdCAAAAATAGTAAGCGACATCCTGTG1,201
    yycFG-1RevGTGATAGTGCTTTTTGGACAGAAC
    yycFG-2FwdAAGTGGCTAAAACAACTACAATCCC1,056
    yycFG-2RevTGTTTCCTGCACAATCGTACTAAAG
    yycFG-3FwdACGTAGACTGGACTCAGTTATCACC1,098
    yycFG-3RevATACGACACTCATCAAGACGAGTAG
Additional yycF and yycG primers for sequence determination
    yycFG-1FwdSGCATACGATGGTAATGATGCAG
    yycFG-2FwdSGCTCCGTAAATGCACAAAAAG
    yycFG-3FwdSTGCAGGAAACAGGATTTGTAAC
mprF-amplificationa
    mprF-1FwdATGGTGCTTATAATGTTGGGCAG1,046
    mprF-1RevCGACACTAAAGTGCAGTACAATC
    mprF-2FwdGATAAGATTACATGGGTAAGATGGG1,002
    mprF-2RevCCAGAAGTAATAGCGCAATACAG
    mprF-3FwdTATTGTAGCTTTCCGTAGAGCAC915
    mprF-3RevGGCAACCATCTAATTAAATCGACTG
    mprF-4FwdCAAGTTACAGATCAACACATGCC964
    mprF-4RevGCAGAAGAACAAAAAATACGCCAAG
Additional mprF primers for sequence determination
    mprF-1RevSCCGAAACCTACAATCGCATTC
    mprF-2RevSACGGAAAGCTACAATAAGCAG
    mprF-3FwdSGGTATGATTGCATGGTTGTTTG
    mprF-4RevSTGTGACGTATTACACGCATTAC
MW2528 amplification
    MW2528-1FwdGCGTATCATCATACCTTACGCATTG1,072
    MW2528-1RevATTGTCATGGATGGGGATTTGCAC
    MW2528-2FwdTGTTGCCCAAACTAAGTCATCTTC960
    MW2528-2RevCTGAGTACAAGCATACACACAAGC
    MW2528-3FwdTCCATCTTTTTGACCGGCAATAAC800
    MW2528-3RevCATTATTACGCTGTGGGAAAATAGG
Intergenic regions
    1512174C-G FwdTGTAATGTCATCAAGGTGTCTC709
    1512174C-G RevCGTAACCCTCAAACTGGTAAAG
    1654504C-T FwdTTGTTCAACCCAAGTATCTCCAGC902
    1654504C-T RevACAATTTGAAGGTGACGAATCACTC
    2041052C-G FwdGGCTTGCGCTTCATTAACCAATTC994
    2041052C-G RevCACATAAATAACCCCAAGTCTGCTG
    2705330T-C FwdAAGTAATTCGTCAACGCGGTCAAC769
    2705330T-C RevTTTAGCAGAGGCAAACATGGGCAC
grlA amplification and sequencing primers for ciprofloxacin resistance validation
    LF-3GCATTGCCAGATGTTCGTG278
    LF-4GCTTCAGTGTAACGCATTGC
  • a The primers designed for PCR amplification were also used to sequence the PCR products.