TABLE 1.

Primers used in this study

Primer nameaSequence (5′ to 3′)PurposebNucleotidescGenBank accession no.
E. coli ampD
    ampDUFCTCTTCAACCCAGCGTTTGCA118418-118437NC_000913
    ampDAKRGCACTGGCAGCTTGATCATCGA119360-119340NC_000913
C. freundii ampD
    CFampDFCCAGAAGCGCGTCACGTCGGA18-37Z14002
    CFampDRTCATGTCATCTCCTTGTGTGACGA717-695Z14002
    XIR1dCTACTCGGGCCGCAATATTGCA635-617Z14002
    XIR2CTAGGGATCGGTCTTACGCTCGA648-630Z14002
    XIR3CTAGCTAAACCTTGCCCAAGTCA680-661Z14002
P. aeruginosa ampD
    PAampDFGACGATGCCTTGCTGTTCGA436-454AF082575
    PAampDRGCAGCAATGTCAGCAACAGGA1422-1403AF082575
C. freundii
    CFRRNAFeGTTGTGGTTAATAACCGCAGCGR436-457AJ233408
    CFRRNARGCTTTACGCCCAGTAATTCCGR556-536AJ233408
    CFampCFCGAAGCCTATGGCGTGAAATCR1772-1792AY125469
    CFampCRCCAATACGCCAGTAGCGAGR1906-1888AY125469
    CFampDFGCATGTTGTTAGACGAGGGR152-170Z14002
    CFampDRCGGCAGGCTGATATTATGCR270-252Z14002
  • a Primer names ending with F represent forward primers; those ending with R represent reverse primers.

  • b Purpose for the primers: A, amplification, cloning, and sequencing; R, real-time RT-PCR.

  • c Nucleotide location of each primer with respect to the GenBank accession number cited, listed 5′-3′.

  • d XIR1, XIR2, and XIR3 primers bind internal to the ampD gene and contain an in-frame stop codon.

  • e Primers used to amplify 16S rRNA from C. freundii as an endogenous control for real-time RT-PCR experiments.